Transcript: Human NM_033484.2

Homo sapiens F-box protein 4 (FBXO4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
FBXO4 (26272)
Length:
1745
CDS:
57..980

Additional Resources:

NCBI RefSeq record:
NM_033484.2
NBCI Gene record:
FBXO4 (26272)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034322 CGATTGATGTACAGCTATATA pLKO.1 244 CDS 100% 15.000 21.000 N FBXO4 n/a
2 TRCN0000034323 CCTATATCTGAGGTCACTGAT pLKO.1 435 CDS 100% 4.950 6.930 N FBXO4 n/a
3 TRCN0000420271 CAGTTGAACAACCAACATAAA pLKO_005 726 CDS 100% 13.200 9.240 N FBXO4 n/a
4 TRCN0000433092 GTATTGGATCAGGAGTCAATT pLKO_005 703 CDS 100% 13.200 9.240 N FBXO4 n/a
5 TRCN0000034319 CCAGGTTTGGAAGAATTGAAT pLKO.1 606 CDS 100% 5.625 3.375 N FBXO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02947 pDONR223 100% 78.9% 77.5% None (many diffs) n/a
2 ccsbBroad304_02947 pLX_304 0% 78.9% 77.5% V5 (many diffs) n/a
3 TRCN0000469091 CTCCCCTACCCATATACACTCTTT pLX_317 41.9% 78.9% 77.5% V5 (many diffs) n/a
Download CSV