Construct: ORF TRCN0000469096
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001534.1_s317c1
- Derived from:
- ccsbBroadEn_07818
- DNA Barcode:
- TACAAGACCATCACGAGGCATGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KIFAP3 (22920)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469096
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 22920 | KIFAP3 | kinesin associated protein 3 | NM_014970.4 | 99.9% | 100% | 1065T>C |
| 2 | human | 22920 | KIFAP3 | kinesin associated protein 3 | XM_024454186.1 | 97.8% | 96.9% | (many diffs) |
| 3 | human | 22920 | KIFAP3 | kinesin associated protein 3 | XM_005244970.2 | 97.1% | 95.3% | 1065T>C;2274_2310del;2382_2383ins31 |
| 4 | human | 22920 | KIFAP3 | kinesin associated protein 3 | XM_011509307.3 | 96.8% | 94% | (many diffs) |
| 5 | human | 22920 | KIFAP3 | kinesin associated protein 3 | NM_001204517.1 | 94.9% | 94.9% | 0_1ins120;945T>C |
| 6 | human | 22920 | KIFAP3 | kinesin associated protein 3 | XM_024454187.1 | 94.7% | 91.1% | (many diffs) |
| 7 | human | 22920 | KIFAP3 | kinesin associated protein 3 | NM_001204516.1 | 94.4% | 94.3% | 32_33ins132;933T>C |
| 8 | human | 22920 | KIFAP3 | kinesin associated protein 3 | NM_001204514.1 | 89.1% | 85.9% | (many diffs) |
| 9 | mouse | 16579 | Kifap3 | kinesin-associated protein 3 | NM_001305643.1 | 88.8% | 97.7% | (many diffs) |
| 10 | mouse | 16579 | Kifap3 | kinesin-associated protein 3 | XM_006496679.3 | 85.9% | 94.6% | (many diffs) |
| 11 | mouse | 16579 | Kifap3 | kinesin-associated protein 3 | NM_010629.3 | 85.7% | 93.9% | (many diffs) |
| 12 | mouse | 16579 | Kifap3 | kinesin-associated protein 3 | XM_006496681.3 | 83% | 90.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2442
- ORF length:
- 2376
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca aggggaggac gccagatacc tcaaaaggaa agttaaagga gggaatatag 121 atgtacatcc atcagaaaaa gcactcattg ttcactatga agtggaagct accattcttg 181 gagaaatggg ggaccccatg ttgggagaac gaaaagaatg tcaaaaaatc attcgactta 241 agagtctcaa tgccaacaca gatataactt ccctggcaag gaaggtggtt gaagaatgta 301 aactcattca tccttcaaaa ctaaatgagg tagaacagct gttgtactat ctacagaacc 361 gccgtgattc attgtcagga aaagagaaaa aagaaaaatc aagcaagcct aaagatccac 421 ctccttttga aggaatggag attgatgaag ttgctaacat taatgacatg gatgaatata 481 ttgagttatt atatgaagat attcctgaca aagttcgggg ttctgctttg atcctgcagc 541 ttgctcgaaa tcctgataac ttggaagaac tactattgaa tgaaactgcc cttggtgcat 601 tagcaagggt cctgagagaa gactggaagc aaagtgtcga gttagctaca aacataattt 661 acatcttttt ttgtttctcc agcttttctc aatttcatgg acttattact cactataaaa 721 ttggagctct gtgtatgaat attattgatc atgagttaaa aagacatgag ctttggcaag 781 aagaactctc aaagaagaag aaagctgttg atgaagaccc tgaaaaccaa accttgagaa 841 aggattatga aaaaaccttt aaaaagtacc aggggcttgt ggtaaaacag gaacagctat 901 tacgagttgc tctttatttg cttctgaatc ttgctgagga tactcgtacc gaactgaaaa 961 tgaggaacaa gaacatagtt cacatgttgg tgaaagccct tgatcgggac aattttgagc 1021 tgctaatttt agttgtgtca ttcttgaaga aactcagcat ttttatggag aataaaaatg 1081 atatggtgga aatggatatt gttgaaaaac tggtgaaaat gataccttgc gagcatgaag 1141 acctgctgaa tatcaccctc cgacttttac taaacctatc ctttgacaca ggactgagga 1201 ataagatggt acaagttgga ctgcttccca agctcactgc actcctaggc aatgacaact 1261 acaaacaaat agcaatgtgt gttctttacc acataagcat ggatgaccgc tttaaatcaa 1321 tgtttgcata cactgactgt ataccacagt taatgaagat gctgtttgaa tgttcagatg 1381 aacgaattga cttggaactc atttctttct gcattaatct tgctgctaac aaaagaaatg 1441 tacagcttat ctgtgaagga aatgggctga agatgctcat gaagagggct ctgaagttta 1501 aggatccatt gctgatgaaa atgattagaa acatttctca gcatgatgga ccaactaaaa 1561 atctgtttat tgattatgtt ggggaccttg cagcccagat ctctaatgat gaagaagagg 1621 agtttgtgat tgaatgtttg ggaactcttg caaacttgac cattccagac ttagactggg 1681 aattggttct taaagaatat aagttggttc catacctcaa ggataaacta aaaccaggtg 1741 ctgcagaaga tgatcttgtt ttagaagtgg ttataatgat tggaactgta tccatggatg 1801 actcttgtgc tgcattgcta gccaaatctg gcataatccc tgcactcatt gaattgctaa 1861 atgctcaaca agaagatgat gaatttgtgt gtcagataat ttatgtcttc taccagatgg 1921 ttttccacca agccacaaga gacgtcataa tcaaggaaac acaggctcca gcatatctca 1981 tagacctaat gcatgataag aataatgaaa tccgaaaggt ctgtgataat acattagata 2041 ttatagcgga atatgatgaa gaatgggcta agaaaattca gagtgaaaag tttcgctggc 2101 ataactctca gtggctGGAG ATGGTAGAGA GTCGTCAGAT GGATGAGAGT GAGCAGTACT 2161 TGTATGGTGA TGATCGAATT GAGCCATACA TTCATGAAGG AGATATTCTC GAAAGACCTG 2221 ACCTTTTCTA CAACTCAGAT GGATTAATTG CCTCTGAAGG AGCCATAAGT CCCGATTTCT 2281 TCAATGATTA CCACCTTCAA AATGGAGATG TTGTTGGGCA GCATTCATTT CCTGGCAGCC 2341 TTGGAATGGA TGGCTTTGGC CAACCAGTTG GCATTCTTGG ACGCCCTGCC ACAGCATATG 2401 GATTCCGCCC TGATGAACCT TACTACTATG GCTATGGATC TTGCCCAACT TTCTTGTACA 2461 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 2521 AATGAACTAG TCCGTAACTT GAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA 2581 GGACGATACA AGACCATCAC GAGGCATGGC ACGCGTTAAG TCgacaatca acctctggat 2641 tacaaaattt gtgaaagatt