Transcript: Human XM_024454187.1

PREDICTED: Homo sapiens kinesin associated protein 3 (KIFAP3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIFAP3 (22920)
Length:
2932
CDS:
93..2456

Additional Resources:

NCBI RefSeq record:
XM_024454187.1
NBCI Gene record:
KIFAP3 (22920)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432050 GGACTTATTACTCACTATAAA pLKO_005 771 CDS 100% 15.000 12.000 N KIFAP3 n/a
2 TRCN0000432923 TTGATGAAGTTGCTAACATTA pLKO_005 514 CDS 100% 13.200 9.240 N KIFAP3 n/a
3 TRCN0000117241 CCAAACCTTGAGAAAGGATTA pLKO.1 899 CDS 100% 10.800 7.560 N KIFAP3 n/a
4 TRCN0000117237 CCCTCTGTCTTCTGTTAAGTA pLKO.1 2740 3UTR 100% 5.625 3.938 N KIFAP3 n/a
5 TRCN0000117240 CCTGATAACTTGGAAGAACTA pLKO.1 624 CDS 100% 4.950 3.465 N KIFAP3 n/a
6 TRCN0000117239 CCAGCATATCTCATAGACCTA pLKO.1 2040 CDS 100% 2.640 1.848 N KIFAP3 n/a
7 TRCN0000117238 GCCGTGATTCATTGTCAGGAA pLKO.1 433 CDS 100% 2.640 1.848 N KIFAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07818 pDONR223 100% 94.7% 91.1% None (many diffs) n/a
2 ccsbBroad304_07818 pLX_304 0% 94.7% 91.1% V5 (many diffs) n/a
3 TRCN0000469096 TACAAGACCATCACGAGGCATGGC pLX_317 14% 94.7% 91.1% V5 (many diffs) n/a
Download CSV