Construct: ORF TRCN0000469104
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016232.1_s317c1
- Derived from:
- ccsbBroadEn_00569
- DNA Barcode:
- GCGCGAGTGAGTCCCCGGTAGCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FHL3 (2275)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469104
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2275 | FHL3 | four and a half LIM domains 3 | NM_004468.5 | 100% | 100% | |
| 2 | human | 2275 | FHL3 | four and a half LIM domains 3 | XM_024454099.1 | 100% | 100% | |
| 3 | human | 2275 | FHL3 | four and a half LIM domains 3 | XM_024454100.1 | 100% | 100% | |
| 4 | human | 2275 | FHL3 | four and a half LIM domains 3 | XM_024454101.1 | 100% | 100% | |
| 5 | human | 2275 | FHL3 | four and a half LIM domains 3 | NM_001243878.2 | 61.4% | 61.4% | 0_1ins324 |
| 6 | human | 2275 | FHL3 | four and a half LIM domains 3 | XM_017000675.1 | 52.5% | 38.8% | 0_1ins229;101_102ins170 |
| 7 | mouse | 14201 | Fhl3 | four and a half LIM domains 3 | NM_010213.3 | 86.8% | 94.4% | (many diffs) |
| 8 | mouse | 14201 | Fhl3 | four and a half LIM domains 3 | XM_006502768.3 | 86.8% | 94.4% | (many diffs) |
| 9 | mouse | 14201 | Fhl3 | four and a half LIM domains 3 | XM_006502766.3 | 82.8% | 90% | (many diffs) |
| 10 | mouse | 14201 | Fhl3 | four and a half LIM domains 3 | XM_006502769.3 | 53.7% | 56.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 906
- ORF length:
- 840
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cgagtcattt gactgtgcaa aatgcaacga gtccctgtat ggacgcaagt 121 acatccagac agacagcggc ccctactgtg tgccctgcta tgacaatacc tttgccaaca 181 cctgtgctga gtgccagcag cttatcgggc atgactcgag ggagctgttc tatgaagacc 241 gccatttcca cgagggctgc ttccgctgct gccgctgcca gcgctcacta gccgatgaac 301 ccttcacctg ccaggacagt gagctgctct gcaatgactg ctactgcagt gcgttttcct 361 cgcagtgctc cgcttgtggg gagactgtca tgcctgggtc ccggaagctg gaatatggag 421 gccagacatg gcatgagcac tgcttcctgt gcagtggctg tgaacagcca ctgggctccc 481 gttcttttgt gcccgacaag ggtgctcact actgcgtgcc cTGCTATGAG AACAAGTTTG 541 CTCCTCGCTG CGCCCGCTGC AGCAAGACGC TGACACAGGG TGGAGTGACA TACCGTGATC 601 AGCCGTGGCA TCGAGAATGT CTGGTCTGTA CCGGATGCCA GACGCCCCTG GCAGGGCAGC 661 AGTTCACCTC CCGGGATGAA GATCCCTACT GTGTGGCCTG TTTTGGAGAA CTCTTTGCAC 721 CTAAGTGCAG CAGCTGCAAG CGCCCCATCG TAGGACTCGG TGGAGGCAAG TATGTGTCCT 781 TTGAAGACCG ACACTGGCAC CACAACTGCT TCTCCTGCGC CCGCTGCTCT ACCTCCCTGG 841 TGGGCCAGGG CTTCGTACCG GATGGAGACC AAGTGCTCTG CCAGGGCTGT AGCCAGGCAG 901 GGCCCTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 961 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1021 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGCGCGAGTG AGTCCCCGGT AGCTCACGCG 1081 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt