Transcript: Mouse XM_006502768.3

PREDICTED: Mus musculus four and a half LIM domains 3 (Fhl3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fhl3 (14201)
Length:
2068
CDS:
558..1427

Additional Resources:

NCBI RefSeq record:
XM_006502768.3
NBCI Gene record:
Fhl3 (14201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502768.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423035 ACTCGGTGGAGGCAAGTATGT pLKO_005 1274 CDS 100% 4.950 6.930 N FHL3 n/a
2 TRCN0000226329 GTCCTTCGAAGACCGACATTG pLKO_005 1295 CDS 100% 10.800 8.640 N Fhl3 n/a
3 TRCN0000226331 CAAGACTTCTAGGGTAGATTT pLKO_005 1754 3UTR 100% 13.200 9.240 N Fhl3 n/a
4 TRCN0000218521 TGCCTTGCTATGAGAACAAAT pLKO_005 1009 CDS 100% 13.200 9.240 N Fhl3 n/a
5 TRCN0000226330 AGACGGAGATCAAGTTCTATG pLKO_005 1379 CDS 100% 10.800 7.560 N Fhl3 n/a
6 TRCN0000226328 CCTGCTTTGGAGAACTCTTTG pLKO_005 1189 CDS 100% 10.800 7.560 N Fhl3 n/a
7 TRCN0000113526 CCGCAAATACATCCAGACAGA pLKO.1 605 CDS 100% 2.640 1.848 N Fhl3 n/a
8 TRCN0000113528 CTATGACAACACCTTCGCCAA pLKO.1 650 CDS 100% 2.160 1.512 N Fhl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502768.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00569 pDONR223 100% 86.8% 94.4% None (many diffs) n/a
2 ccsbBroad304_00569 pLX_304 0% 86.8% 94.4% V5 (many diffs) n/a
3 TRCN0000469104 GCGCGAGTGAGTCCCCGGTAGCTC pLX_317 45.9% 86.8% 94.4% V5 (many diffs) n/a
4 ccsbBroadEn_10822 pDONR223 100% 53.8% 58.1% None (many diffs) n/a
5 ccsbBroad304_10822 pLX_304 0% 53.8% 58.1% V5 (many diffs) n/a
Download CSV