Construct: ORF TRCN0000469294
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004367.1_s317c1
- Derived from:
- ccsbBroadEn_04593
- DNA Barcode:
- GACCGCAACTACCGCAAATAGGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UBE2Q2 (92912)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469294
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | NM_173469.4 | 100% | 100% | |
| 2 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | NM_001284382.2 | 90.6% | 90.6% | 281_282ins105 |
| 3 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | NM_001145335.1 | 87.5% | 83.2% | (many diffs) |
| 4 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XM_024450107.1 | 80.4% | 79.2% | (many diffs) |
| 5 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XM_005254788.2 | 78.9% | 78.9% | 588_589ins237 |
| 6 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XM_005254787.2 | 78.2% | 77.5% | (many diffs) |
| 7 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XM_017022728.2 | 69.6% | 69.6% | 281_282ins105;483_484ins237 |
| 8 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XM_017022727.2 | 69.1% | 68.4% | (many diffs) |
| 9 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XM_017022726.1 | 66.8% | 61.9% | (many diffs) |
| 10 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XM_024450108.1 | 59.4% | 58.1% | (many diffs) |
| 11 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XM_006720770.2 | 57.7% | 56.9% | (many diffs) |
| 12 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XM_011522228.2 | 52.8% | 52.2% | 588_589ins23;592_593insTCAG;594_595ins504 |
| 13 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XR_001751420.2 | 34.1% | 1_324del;912_913ins85;1365_2956del | |
| 14 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XR_002957691.1 | 34% | (many diffs) | |
| 15 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XR_001751421.2 | 32.1% | 1_324del;912_913ins146;1304_2895del | |
| 16 | human | 92912 | UBE2Q2 | ubiquitin conjugating enzym... | XR_002957692.1 | 29.8% | (many diffs) | |
| 17 | mouse | 109161 | Ube2q2 | ubiquitin-conjugating enzym... | NM_180600.3 | 92.9% | 94.7% | (many diffs) |
| 18 | mouse | 109161 | Ube2q2 | ubiquitin-conjugating enzym... | NM_001346657.1 | 83.9% | 86% | (many diffs) |
| 19 | mouse | 109161 | Ube2q2 | ubiquitin-conjugating enzym... | NM_001346658.1 | 64.1% | 66.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1191
- ORF length:
- 1125
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cgtgtcaggg ctcaaggccg agctgaagtt cctggcgtcc atcttcgaca 121 agaaccacga gcgattccgc atcgtcagtt ggaagctgga cgagctgcac tgccagttcc 181 tggtgccgca gcagggcagc ccgcactcgc tgccgccgcc actcacgctc cactgcaaca 241 tcacggaatc ctatccatct tcttcaccga tatggtttgt ggattctgaa gacccaaatc 301 tgacatcagt tctggaacgt ctagaagata ctaagaacaa caatttgctt cgtcagcaat 361 tgaagtggtt gatatgtgaa ctctgcagtt tatataacct tcctaagcac ctggatgttg 421 agatgctaga tcaaccacta cccacgggtc agaatgggac aacagaagaa gtgacttcag 481 aagaagagga agaagaagaa gagatggctg aagatataga agacttagat cactatgaga 541 tgaaggaaga agagcctatt agtgggaaaa agtcagagga tgaaggaatt gaaaaagaaa 601 atttggcaat attagagaaa attaggaaga ctcaaaggca agaccattta aatggtgcag 661 tgtctgggtc agtgcaagcT TCAGATAGAC TTATGAAAGA GCTCAGGGAC ATATACAGAT 721 CACAGAGTTA TAAAACAGGG ATTTATTCAG TGGAACTCAT AAATGACAGT TTATATGACT 781 GGCATGTTAA ACTGCAGAAG GTTGACCCTG ATAGTCCTTT GCACAGTGAT CTTCAGATCT 841 TAAAAGAAAA AGAAGGCATA GAATATATTT TGCTTAACTT CTCTTTTAAG GATAACTTTC 901 CATTTGATCC TCCATTTGTT CGAGTGGTGT TACCTGTTCT CTCAGGAGGG TATGTATTGG 961 GTGGAGGAGC ATTATGTATG GAACTTCTCA CAAAACAGGG CTGGAGCAGT GCCTACTCAA 1021 TAGAATCGGT CATCATGCAA ATAAATGCCA CCTTAGTCAA AGGCAAAGCC AGAGTGCAGT 1081 TTGGAGCAAA TAAGAATCAA TATAATCTAG CAAGAGCCCA ACAATCCTAT AATTCCATTG 1141 TACAGATACA TGAGAAAAAT GGCTGGTACA CCCCTCCAAA GGAAGATGGC TACCCAACTT 1201 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1261 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1321 CTTGTGGAAA GGACGAGACC GCAACTACCG CAAATAGGGA ACGCGTTAAG TCgacaatca 1381 acctctggat tacaaaattt gtgaaagatt