Transcript: Human XM_006720770.2

PREDICTED: Homo sapiens ubiquitin conjugating enzyme E2 Q2 (UBE2Q2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBE2Q2 (92912)
Length:
2592
CDS:
325..1032

Additional Resources:

NCBI RefSeq record:
XM_006720770.2
NBCI Gene record:
UBE2Q2 (92912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007757 CCATTTGTTCGAGTGGTGTTA pLKO.1 934 CDS 100% 4.950 3.465 N UBE2Q2 n/a
2 TRCN0000007756 CTGGATGTTGAGATGCTAGAT pLKO.1 670 CDS 100% 4.950 3.465 N UBE2Q2 n/a
3 TRCN0000436691 GATACTAAGAACAACAATTTG pLKO_005 586 CDS 100% 13.200 7.920 N UBE2Q2 n/a
4 TRCN0000418261 TGATAGGAAACCTACTCATTA pLKO_005 1501 3UTR 100% 13.200 7.920 N UBE2Q2 n/a
5 TRCN0000007753 GCACAAAGACTCCTTGAGCAA pLKO.1 1838 3UTR 100% 2.640 1.584 N UBE2Q2 n/a
6 TRCN0000177221 GAGGAAGAAGAAGAAGAGATA pLKO.1 745 CDS 100% 4.950 2.475 Y Cnpy4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04593 pDONR223 100% 57.7% 56.9% None (many diffs) n/a
2 ccsbBroad304_04593 pLX_304 0% 57.7% 56.9% V5 (many diffs) n/a
3 TRCN0000469294 GACCGCAACTACCGCAAATAGGGA pLX_317 45.5% 57.7% 56.9% V5 (many diffs) n/a
Download CSV