Transcript: Human XR_002957691.1

PREDICTED: Homo sapiens ubiquitin conjugating enzyme E2 Q2 (UBE2Q2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBE2Q2 (92912)
Length:
3065
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957691.1
NBCI Gene record:
UBE2Q2 (92912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436280 GCAAGCTTCAGATAGACTTAT pLKO_005 933 3UTR 100% 13.200 9.240 N UBE2Q2 n/a
2 TRCN0000007757 CCATTTGTTCGAGTGGTGTTA pLKO.1 1407 3UTR 100% 4.950 3.465 N UBE2Q2 n/a
3 TRCN0000007756 CTGGATGTTGAGATGCTAGAT pLKO.1 670 3UTR 100% 4.950 3.465 N UBE2Q2 n/a
4 TRCN0000434415 ATACAGATCACAGAGTTATAA pLKO_005 972 3UTR 100% 15.000 9.000 N UBE2Q2 n/a
5 TRCN0000436691 GATACTAAGAACAACAATTTG pLKO_005 586 3UTR 100% 13.200 7.920 N UBE2Q2 n/a
6 TRCN0000418261 TGATAGGAAACCTACTCATTA pLKO_005 1974 3UTR 100% 13.200 7.920 N UBE2Q2 n/a
7 TRCN0000007753 GCACAAAGACTCCTTGAGCAA pLKO.1 2311 3UTR 100% 2.640 1.584 N UBE2Q2 n/a
8 TRCN0000177221 GAGGAAGAAGAAGAAGAGATA pLKO.1 745 3UTR 100% 4.950 2.475 Y Cnpy4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04593 pDONR223 100% 34% None (many diffs) n/a
2 ccsbBroad304_04593 pLX_304 0% 34% V5 (many diffs) n/a
3 TRCN0000469294 GACCGCAACTACCGCAAATAGGGA pLX_317 45.5% 34% V5 (many diffs) n/a
Download CSV