Construct: ORF TRCN0000469398
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009751.1_s317c1
- Derived from:
- ccsbBroadEn_05169
- DNA Barcode:
- ATGGCTGAAACGTTTTGAGTCATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PLPP4 (196051)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469398
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | NM_001030059.2 | 100% | 100% | |
| 2 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_006717685.4 | 94.7% | 92.9% | (many diffs) |
| 3 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_011539444.3 | 93.9% | 90.3% | (many diffs) |
| 4 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_011539445.2 | 82.3% | 76.7% | (many diffs) |
| 5 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_006717686.4 | 80% | 75.4% | (many diffs) |
| 6 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_005269592.2 | 78.9% | 78.5% | 445_446ins171 |
| 7 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_017015820.1 | 77% | 69.8% | (many diffs) |
| 8 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | NM_001318167.1 | 76.7% | 76.3% | 256_257ins189 |
| 9 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | NM_001318166.1 | 71.2% | 43.6% | 320_321ins125;579_580ins109 |
| 10 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_017015821.2 | 55.3% | 55.3% | 0_1ins363 |
| 11 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_017015822.1 | 55.3% | 55.3% | 0_1ins363 |
| 12 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_024447860.1 | 55.3% | 55.3% | 0_1ins363 |
| 13 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_024447861.1 | 55.3% | 55.3% | 0_1ins363 |
| 14 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_024447862.1 | 55.3% | 55.3% | 0_1ins363 |
| 15 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | NR_134516.1 | 39.3% | (many diffs) | |
| 16 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | NM_001318169.1 | 35.4% | 25.1% | 165_166ins451;288_289ins74 |
| 17 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | NM_001318168.1 | 35.4% | 23.9% | 164_165ins280;288_289ins245 |
| 18 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_017015823.1 | 35.4% | 23.9% | 164_165ins280;288_289ins245 |
| 19 | human | 196051 | PLPP4 | phospholipid phosphatase 4 | XM_017015824.2 | 35.4% | 23.9% | 164_165ins280;288_289ins245 |
| 20 | mouse | 381925 | Plpp4 | phospholipid phosphatase 4 | NM_001080963.1 | 92.1% | 99.2% | (many diffs) |
| 21 | mouse | 381925 | Plpp4 | phospholipid phosphatase 4 | XM_017322323.1 | 91.8% | 98.8% | (many diffs) |
| 22 | mouse | 381925 | Plpp4 | phospholipid phosphatase 4 | XM_017322324.1 | 70.1% | 76% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 882
- ORF length:
- 813
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcgggagctg gccattgaga tcggggtgcg agccctgctc ttcggagtct 121 tcgtttttac agagtttttg gatccgttcc agagagtcat ccagccagaa gagatctggc 181 tctataaaaa tcctttggtg caatcagata acatacctac ccgcctcatg tttgcaattt 241 ctttcctcac acccctggct gttatttgtg tggtgaaaat tatccggcga acagacaaga 301 ctgaaattaa ggaagccttc ttagcggtgt ccttggctct tgctttgaat ggagtctgca 361 caaacactat taaattaata gtgggaagac ctcgccccga tttcttttac cgctgctttc 421 cagatggagt gatgaactcg gaaatgcatt gcacaggtga ccccgatctg gtgtccgagg 481 gccgcaaaag cttccccagc atccattcct cctttgcctt ttcgggcctt GGCTTCACGA 541 CGTTCTACTT GGCGGGCAAG CTGCACTGCT TCACCGAGAG TGGGCGGGGA AAGAGCTGGC 601 GGCTCTGTGC TGCCATCCTG CCCTTGTACT GCGCCATGAT GATTGCCCTG TCCCGCATGT 661 GCGACTACAA GCATCACTGG CAAGATTCCT TTGTGGGTGG AGTCATCGGC CTCATTTTTG 721 CATACATTTG CTACAGACAG CACTATCCTC CTCTGGCCAA CACAGCTTGC CATAAACCCT 781 ACGTTAGTCT GCGAGTCCCA GCCTCACTGA AGAAAGAGGA GAGGCCCACA GCTGACAGCG 841 CACCCAGCTT GCCTCTGGAG GGGATCACCG AAGGCCCGGT ATTGCCAACT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGAATG GCTGAAACGT TTTGAGTCAT TACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t