Transcript: Human XM_024447862.1

PREDICTED: Homo sapiens phospholipid phosphatase 4 (PLPP4), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLPP4 (196051)
Length:
11346
CDS:
273..725

Additional Resources:

NCBI RefSeq record:
XM_024447862.1
NBCI Gene record:
PLPP4 (196051)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447862.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052735 CCCGCCTCATGTTTGCAATTT pLKO.1 96 5UTR 100% 13.200 18.480 N PLPP4 n/a
2 TRCN0000360271 TGGAGTGATGAACTCGGAAAT pLKO_005 266 5UTR 100% 10.800 15.120 N PLPP4 n/a
3 TRCN0000052733 GCTTGCCATAAACCCTACGTT pLKO.1 606 CDS 100% 3.000 4.200 N PLPP4 n/a
4 TRCN0000360270 GTCTGCACAAACACTATTAAA pLKO_005 230 5UTR 100% 15.000 12.000 N PLPP4 n/a
5 TRCN0000360201 GAAGAGATCTGGCTCTATAAA pLKO_005 44 5UTR 100% 15.000 10.500 N PLPP4 n/a
6 TRCN0000360272 TGGTGCAATCAGATAACATAC pLKO_005 72 5UTR 100% 10.800 7.560 N PLPP4 n/a
7 TRCN0000080692 GCCTCATGTTTGCAATTTCTT pLKO.1 99 5UTR 100% 5.625 3.938 N Plpp4 n/a
8 TRCN0000052734 GCTGTTATTTGTGTGGTGAAA pLKO.1 134 5UTR 100% 4.950 3.465 N PLPP4 n/a
9 TRCN0000052736 CATTTGCTACAGACAGCACTA pLKO.1 566 CDS 100% 4.050 2.835 N PLPP4 n/a
10 TRCN0000052737 CCAGAAGAGATCTGGCTCTAT pLKO.1 41 5UTR 100% 0.495 0.347 N PLPP4 n/a
11 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 6416 3UTR 100% 10.800 5.400 Y MRPS16 n/a
12 TRCN0000178912 CCGGAATTTGAATCCTGCAAT pLKO.1 10802 3UTR 100% 4.950 2.475 Y LINC01561 n/a
13 TRCN0000179518 GAATCTTGAGTGTCCAGATCA pLKO.1 9736 3UTR 100% 4.950 2.475 Y LINC01561 n/a
14 TRCN0000183438 GCAGTGAATTTGGTTGTTCTT pLKO.1 10869 3UTR 100% 4.950 2.475 Y LINC01561 n/a
15 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 6416 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447862.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13366 pDONR223 100% 66.8% 55.8% None (many diffs) n/a
2 ccsbBroad304_13366 pLX_304 0% 66.8% 55.8% V5 (many diffs) n/a
3 TRCN0000477433 AGCACGCCCTCCCTGCCATATACC pLX_317 55.9% 66.8% 55.8% V5 (many diffs) n/a
4 ccsbBroadEn_05169 pDONR223 100% 55.3% 55.3% None 0_1ins363 n/a
5 ccsbBroad304_05169 pLX_304 0% 55.3% 55.3% V5 0_1ins363 n/a
6 TRCN0000469398 ATGGCTGAAACGTTTTGAGTCATT pLX_317 43.3% 55.3% 55.3% V5 0_1ins363 n/a
Download CSV