Transcript: Human NM_183401.3

Homo sapiens ring finger protein 14 (RNF14), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RNF14 (9604)
Length:
4237
CDS:
311..1735

Additional Resources:

NCBI RefSeq record:
NM_183401.3
NBCI Gene record:
RNF14 (9604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_183401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231558 GTACTGGCTGTATGCAATATT pLKO_005 1575 CDS 100% 15.000 21.000 N RNF14 n/a
2 TRCN0000231559 TGGATGTTGACGACGATATTT pLKO_005 1692 CDS 100% 15.000 21.000 N RNF14 n/a
3 TRCN0000231557 TTAGTGGAAGCAGAGTTATTT pLKO_005 1154 CDS 100% 15.000 21.000 N RNF14 n/a
4 TRCN0000003444 CCCAAAGCTCTGAATAGTTAA pLKO.1 1992 3UTR 100% 13.200 18.480 N RNF14 n/a
5 TRCN0000257357 CAAGCGGATGAGGCTAATAAA pLKO_005 1406 CDS 100% 15.000 12.000 N RNF14 n/a
6 TRCN0000231560 AGTAACTTTGCGGGATATTTA pLKO_005 1798 3UTR 100% 15.000 10.500 N RNF14 n/a
7 TRCN0000003442 AGGTATGGTAAGAGAGTGATT pLKO.1 1442 CDS 100% 4.950 3.465 N RNF14 n/a
8 TRCN0000003443 CCACCTTCATTCACACTTAGT pLKO.1 572 CDS 100% 4.950 3.465 N RNF14 n/a
9 TRCN0000010786 CTGTGGATGTTGACGACGATA pLKO.1 1689 CDS 100% 4.950 3.465 N RNF14 n/a
10 TRCN0000010785 GCTGGGTAGTGAATGCATGTA pLKO.1 991 CDS 100% 4.950 3.465 N RNF14 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3376 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3377 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02209 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02209 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469427 TGAAGGTAACCAAAGAAGTGTCGC pLX_317 27.4% 100% 100% V5 n/a
Download CSV