Construct: ORF TRCN0000469557
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013123.1_s317c1
- Derived from:
- ccsbBroadEn_00845
- DNA Barcode:
- ATTCAATATAGCCGAGTTCTAGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IL1RAP (3556)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469557
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | NM_001167930.2 | 100% | 100% | |
| 2 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | NM_134470.4 | 100% | 100% | |
| 3 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | NM_001364880.2 | 92.2% | 91.1% | (many diffs) |
| 4 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | NM_001167928.2 | 61.4% | 61.7% | 1051_1052insGTAATAGA;1054_1055insGGT;1058_1710del |
| 5 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | NM_001167929.2 | 61.4% | 61.7% | 1051_1052insGTAATAGA;1054_1055insGGT;1058_1710del |
| 6 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | NM_001364881.2 | 61.4% | 61.7% | 1051_1052insGTAATAGA;1054_1055insGGT;1058_1710del |
| 7 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | NM_002182.4 | 61.4% | 61.7% | 1051_1052insGTAATAGA;1054_1055insGGT;1058_1710del |
| 8 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | NM_001167931.2 | 51% | 51.2% | 1051_1052insGTAATAGA;1054_1055insGGT;1058_2061del |
| 9 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | NM_001364879.1 | 51% | 51.2% | 1051_1052insGTAATAGA;1054_1055insGGT;1058_2061del |
| 10 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | XM_017006348.2 | 27.6% | 27.7% | (many diffs) |
| 11 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | NR_157353.2 | 22.9% | (many diffs) | |
| 12 | human | 3556 | IL1RAP | interleukin 1 receptor acce... | NR_157352.2 | 22.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1134
- ORF length:
- 1068
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac acttctgtgg tgtgtagtga gtctctactt ttatggaatc ctgcaaagtg 121 atgcctcaga acgctgcgat gactggggac tagacaccat gaggcaaatc caagtgtttg 181 aagatgagcc agctcgcatc aagtgcccac tctttgaaca cttcttgaaa ttcaactaca 241 gcacagccca ttcagctggc cttactctga tctggtattg gactaggcag gaccgggacc 301 ttgaggagcc aattaacttc cgcctccccg agaaccgcat tagtaaggag aaagatgtgc 361 tgtggttccg gcccactctc ctcaatgaca ctggcaacta tacctgcatg ttaaggaaca 421 ctacatattg cagcaaagtt gcatttccct tggaagttgt tcaaaaagac agctgtttca 481 attcccccat gaaactccca gtgcataaac tgtatataga atatggcatt cagaggatca 541 cttgtccaaa tgtagatgga tattttcctt ccagtgtcaa accgactatc acttggtata 601 tgggctgtta taaaatacag aattttaata atgtaatacc cgaaggtatg aacttgagtt 661 tcctcattgc cTTAATTTCA AATAATGGAA ATTACACATG TGTTGTTACA TATCCAGAAA 721 ATGGACGTAC GTTTCATCTC ACCAGGACTC TGACTGTAAA GGTAGTAGGC TCTCCAAAAA 781 ATGCAGTGCC CCCTGTGATC CATTCACCTA ATGATCATGT GGTCTATGAG AAAGAACCAG 841 GAGAGGAGCT ACTCATTCCC TGTACGGTCT ATTTTAGTTT TCTGATGGAT TCTCGCAATG 901 AGGTTTGGTG GACCATTGAT GGAAAAAAAC CTGATGACAT CACTATTGAT GTCACCATTA 961 ACGAAAGTAT AAGTCATAGT AGAACAGAAG ATGAAACAAG AACTCAGATT TTGAGCATCA 1021 AGAAAGTTAC CTCTGAGGAT CTCAAGCGCA GCTATGTCTG TCATGCTAGA AGTGCCAAAG 1081 GCGAAGTTGC CAAAGCAGCC AAGGTGAAGC AGAAAGGTAA TAGATGCGGT CAGTGCCCAA 1141 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1201 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1261 TATCTTGTGG AAAGGACGAA TTCAATATAG CCGAGTTCTA GTTACGCGTT AAGTCgacaa 1321 tcaacctctg gattacaaaa tttgtgaaag att