Transcript: Human NM_001364880.2

Homo sapiens interleukin 1 receptor accessory protein (IL1RAP), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
IL1RAP (3556)
Length:
3097
CDS:
137..1294

Additional Resources:

NCBI RefSeq record:
NM_001364880.2
NBCI Gene record:
IL1RAP (3556)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058538 CGCATTAGTAAGGAGAAAGAT pLKO.1 407 CDS 100% 5.625 7.875 N IL1RAP n/a
2 TRCN0000372573 TCATTCCCTGTACGGTCTATT pLKO_005 924 CDS 100% 13.200 10.560 N IL1RAP n/a
3 TRCN0000058540 CCCAGTGCATAAACTGTATAT pLKO.1 568 CDS 100% 13.200 9.240 N IL1RAP n/a
4 TRCN0000058541 CGAAGGTATGAACTTGAGTTT pLKO.1 712 CDS 100% 4.950 3.465 N IL1RAP n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1847 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1847 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00845 pDONR223 100% 92.2% 91.1% None (many diffs) n/a
2 ccsbBroad304_00845 pLX_304 0% 92.2% 91.1% V5 (many diffs) n/a
3 TRCN0000469557 ATTCAATATAGCCGAGTTCTAGTT pLX_317 43.4% 92.2% 91.1% V5 (many diffs) n/a
Download CSV