Construct: ORF TRCN0000469570
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017700.1_s317c1
- Derived from:
- ccsbBroadEn_12567
- DNA Barcode:
- GAGATGCATTAAATCCTGTACTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WDR25 (79446)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469570
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79446 | WDR25 | WD repeat domain 25 | NM_001350950.1 | 94.9% | 94.1% | (many diffs) |
| 2 | human | 79446 | WDR25 | WD repeat domain 25 | XM_005268057.3 | 94.6% | 93.1% | (many diffs) |
| 3 | human | 79446 | WDR25 | WD repeat domain 25 | NM_001350949.1 | 91.9% | 88.8% | (many diffs) |
| 4 | human | 79446 | WDR25 | WD repeat domain 25 | XM_011537151.3 | 90.3% | 86.9% | (many diffs) |
| 5 | human | 79446 | WDR25 | WD repeat domain 25 | NM_001161476.2 | 51.8% | 50.1% | (many diffs) |
| 6 | human | 79446 | WDR25 | WD repeat domain 25 | NM_001350947.2 | 51.8% | 50.1% | (many diffs) |
| 7 | human | 79446 | WDR25 | WD repeat domain 25 | NM_001350948.1 | 51.8% | 50.1% | (many diffs) |
| 8 | human | 79446 | WDR25 | WD repeat domain 25 | NM_024515.6 | 51.8% | 50.1% | (many diffs) |
| 9 | mouse | 212198 | Wdr25 | WD repeat domain 25 | NM_177602.3 | 46.6% | 47.2% | (many diffs) |
| 10 | mouse | 212198 | Wdr25 | WD repeat domain 25 | XM_006515657.2 | 46.6% | 47.2% | (many diffs) |
| 11 | mouse | 212198 | Wdr25 | WD repeat domain 25 | XM_006515658.3 | 46.6% | 47.2% | (many diffs) |
| 12 | mouse | 212198 | Wdr25 | WD repeat domain 25 | XM_006515660.3 | 46.6% | 47.2% | (many diffs) |
| 13 | mouse | 212198 | Wdr25 | WD repeat domain 25 | XM_011244054.2 | 46.6% | 47.2% | (many diffs) |
| 14 | mouse | 212198 | Wdr25 | WD repeat domain 25 | XM_011244055.2 | 46.6% | 47.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 927
- ORF length:
- 861
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc agctctgtgc ctggtgctgt gctggtttca agggctgttg ggagaggtat 121 ggaacgccgt ggactccggg cactgcctgc agacctactc cctgcacaca gaggcagtgc 181 gggccgcccg gtgggctccc tgtggccggc gcatcctcag tggtggcttt gacttcgcgc 241 tgcacctaac agaccttgaa acaggaaccc agctatttag tggtcgaagt gactttagaa 301 tcactacctt gaaattccat ccaaaagacc acaacatctt tttatgtgga ggcttcagct 361 ctgaaatgaa agcttgggat ataaggactg gcaaggtgat gagaagctac aaggcgacca 421 tccagcagac cttggacatc ctgttcctcc gggaaggctc cgagttcctg agcagcacag 481 acgcttccac ccgggactca gctgaccgca ccattattgc ctgggatttc cggacctctg 541 ccaaaatctc caaccagatt ttccacgaga ggttcacctg ccccagcctc gccttgcacc 601 cgagagagcc cgtgttcctg gcacagacca atggcaacta cctggccctt ttctccactg 661 tgtggcccta ccggatgagc agacggcggc gctatgaagg gcacaaggtg gagggctact 721 cagtgggctg cgagtgctcc cCAGGCGGTG ACTTGCTGGT GACGGGCAGC GCCGATGGCC 781 GGGTCCTGAT GTACAGCTTC CGCACAGCCA GCCGAGCATG CACACTGCAG GGGCACACAC 841 AGGCCTGTGT CGGCACCACC TACCACCCCG TGCTGCCCTC CGTCCTCGCC ACCTGCTCCT 901 GGGGAGGGGA CATGAAGATC TGGCACTGTC TAACTTTCTT GTACAAAGTG GTTGATATCG 961 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1021 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGAGATGCA 1081 TTAAATCCTG TACTATACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1141 aagatt