Transcript: Human NM_001350950.1

Homo sapiens WD repeat domain 25 (WDR25), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
WDR25 (79446)
Length:
1155
CDS:
33..893

Additional Resources:

NCBI RefSeq record:
NM_001350950.1
NBCI Gene record:
WDR25 (79446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436159 GAAACAGGAACCCAGCTATTT pLKO_005 222 CDS 100% 13.200 9.240 N WDR25 n/a
2 TRCN0000414616 TTAGAATCACTACCTTGAAAT pLKO_005 259 CDS 100% 13.200 9.240 N WDR25 n/a
3 TRCN0000195813 CTCTTCCTCAAGGGTAGATGA pLKO.1 943 3UTR 100% 4.950 3.465 N WDR25 n/a
4 TRCN0000146819 CTGAAATGAAAGCTTGGGATA pLKO.1 325 CDS 100% 4.050 2.835 N WDR25 n/a
5 TRCN0000131089 GCACCATTATTGCCTGGGATT pLKO.1 472 CDS 100% 4.050 2.835 N WDR25 n/a
6 TRCN0000195919 CTCAAGGGTAGATGAGAGGAA pLKO.1 949 3UTR 100% 2.640 1.848 N WDR25 n/a
7 TRCN0000183694 GAAGTGACTTTAGAATCACTA pLKO.1 250 CDS 100% 0.495 0.297 N WDR25 n/a
8 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 1013 3UTR 100% 4.950 2.475 Y YIF1B n/a
9 TRCN0000160434 CAGTTTCCTCATCTGTAAATA pLKO.1 1017 3UTR 100% 15.000 7.500 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12567 pDONR223 100% 94.9% 94.1% None (many diffs) n/a
2 ccsbBroad304_12567 pLX_304 0% 94.9% 94.1% V5 (many diffs) n/a
3 TRCN0000469570 GAGATGCATTAAATCCTGTACTAT pLX_317 22.2% 94.9% 94.1% V5 (many diffs) n/a
Download CSV