Transcript: Mouse XM_006515658.3

PREDICTED: Mus musculus WD repeat domain 25 (Wdr25), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr25 (212198)
Length:
4168
CDS:
1576..3183

Additional Resources:

NCBI RefSeq record:
XM_006515658.3
NBCI Gene record:
Wdr25 (212198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515658.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442025 GCGCAAGCGTGTGTTAGTAAA pLKO_005 3293 3UTR 100% 13.200 18.480 N Wdr25 n/a
2 TRCN0000215900 CAAACCTTCTCATGATCAAAG pLKO.1 1983 CDS 100% 10.800 15.120 N Wdr25 n/a
3 TRCN0000433729 GGGTGACACGCAATCAGTAAG pLKO_005 3335 3UTR 100% 10.800 15.120 N Wdr25 n/a
4 TRCN0000189733 GAACCATTATCGCCTGGGATT pLKO.1 2762 CDS 100% 4.050 5.670 N Wdr25 n/a
5 TRCN0000190248 CGAGTTTCTTAGCAGTACGGA pLKO.1 2715 CDS 100% 0.750 1.050 N Wdr25 n/a
6 TRCN0000431365 GAGTTCATCCAGCCATATTTG pLKO_005 2203 CDS 100% 13.200 9.240 N Wdr25 n/a
7 TRCN0000436719 GGCTTCAGTGACTCGGCTATA pLKO_005 3248 3UTR 100% 10.800 7.560 N Wdr25 n/a
8 TRCN0000421886 TCAGTGGTGGCTTCGACTTTG pLKO_005 2471 CDS 100% 10.800 7.560 N Wdr25 n/a
9 TRCN0000200962 CCCACTATAAGACACCAACAA pLKO.1 3726 3UTR 100% 4.950 3.465 N Wdr25 n/a
10 TRCN0000189706 GCTCCGAGTTTCTTAGCAGTA pLKO.1 2711 CDS 100% 4.050 2.835 N Wdr25 n/a
11 TRCN0000202021 CCAGATCTTCCATGAGAGGTA pLKO.1 2808 CDS 100% 2.640 1.848 N Wdr25 n/a
12 TRCN0000202341 GAGACATCAAGATCTGGCACT pLKO.1 3161 CDS 100% 2.160 1.512 N Wdr25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515658.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12567 pDONR223 100% 46.6% 47.2% None (many diffs) n/a
2 ccsbBroad304_12567 pLX_304 0% 46.6% 47.2% V5 (many diffs) n/a
3 TRCN0000469570 GAGATGCATTAAATCCTGTACTAT pLX_317 22.2% 46.6% 47.2% V5 (many diffs) n/a
Download CSV