Construct: ORF TRCN0000469585
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006955.1_s317c1
- Derived from:
- ccsbBroadEn_00880
- DNA Barcode:
- GAGTATAACCTAGCCAACCTAAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IRF2 (3660)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469585
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3660 | IRF2 | interferon regulatory factor 2 | NM_002199.4 | 100% | 100% | |
| 2 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454034.1 | 100% | 100% | |
| 3 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454035.1 | 100% | 100% | |
| 4 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454036.1 | 100% | 100% | |
| 5 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454037.1 | 99.4% | 99.4% | 526_527insTAGTTG |
| 6 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454038.1 | 99.4% | 99.4% | 526_527insTAGTTG |
| 7 | human | 3660 | IRF2 | interferon regulatory factor 2 | XM_024454039.1 | 84.2% | 84.2% | 362_363ins165 |
| 8 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | NM_008391.4 | 88.8% | 92.5% | (many diffs) |
| 9 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | XM_006509288.3 | 88.8% | 92.5% | (many diffs) |
| 10 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | XM_006509289.3 | 88.8% | 92.5% | (many diffs) |
| 11 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | XM_017312580.1 | 83.7% | 87.2% | (many diffs) |
| 12 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | XM_011242175.2 | 82.2% | 85.6% | (many diffs) |
| 13 | mouse | 16363 | Irf2 | interferon regulatory factor 2 | XR_001778407.1 | 31.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1113
- ORF length:
- 1047
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc ggtggaaagg atgcgcatgc gcccgtggct ggaggagcag ataaactcca 121 acacgatccc ggggctcaag tggcttaaca aggaaaagaa gatttttcag atcccctgga 181 tgcatgcggc tagacatggg tgggatgtgg aaaaagatgc accactcttt agaaactggg 241 caatccatac aggaaagcat caaccaggag tagataaacc tgatcccaaa acatggaagg 301 cgaatttcag atgcgccatg aattccttgc ctgatattga agaagtcaag gataaaagca 361 taaagaaagg aaataatgcc ttcagggtct accgaatgct gcccctatca gaacggcctt 421 ctaagaaagg aaagaaacca aagacagaaa aagaagacaa agttaagcac atcaagcaag 481 aaccagttga gtcatctctg gggcttagta atggagtaag tgatctttct cctgagtatg 541 cggtcctgac ttcaactata aaaaatgaag tggatagtac ggtgaacatc atagttgtag 601 gacagtccca tctggacagc aacattgaga atcaagagat tgtcaccaat ccgccagaca 661 tttgccaagt tGTAGAGGTG ACCACTGAGA GCGACGAGCA GCCGGTCAGC ATGAGCGAGC 721 TCTACCCTCT GCAGATCTCC CCCGTGTCTT CCTATGCAGA AAGCGAAACG ACTGATAGTG 781 TGCCCAGCGA TGAAGAGAGT GCCGAGGGGC GGCCACACTG GCGGAAGAGG AATATTGAAG 841 GCAAACAGTA CCTCAGCAAC ATGGGGACTC GAGGCTCCTA CCTGCTGCCC GGCATGGCGT 901 CCTTCGTCAC TTCCAACAAA CCGGACCTCC AGGTCACCAT CAAAGAGGAG AGCAATCCGG 961 TGCCTTACAA CAGCTCCTGG CCCCCTTTTC AAGACCTCCC CCTTTCTTCC TCCATGACCC 1021 CAGCATCCAG CAGCAGTCGG CCAGACCGGG AGACCCGGGC CAGCGTCATC AAGAAAACAT 1081 CGGATATCAC CCAGGCCCGC GTCAAGAGCT GTTACCCAAC TTTCTTGTAC AAAGTGGTTG 1141 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1201 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGA 1261 GTATAACCTA GCCAACCTAA GCACGCGTTA AGTCgacaat caacctctgg attacaaaat 1321 ttgtgaaaga tt