Transcript: Mouse XM_017312580.1

PREDICTED: Mus musculus interferon regulatory factor 2 (Irf2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Irf2 (16363)
Length:
3798
CDS:
1450..2562

Additional Resources:

NCBI RefSeq record:
XM_017312580.1
NBCI Gene record:
Irf2 (16363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312580.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229581 GGTCCTGACTTCAGCTATAAA pLKO_005 1989 CDS 100% 15.000 21.000 N Irf2 n/a
2 TRCN0000071477 CGGTCCTGACTTCAGCTATAA pLKO.1 1988 CDS 100% 13.200 18.480 N Irf2 n/a
3 TRCN0000071474 GCAGATAAATTCCAATACGAT pLKO.1 1554 CDS 100% 3.000 4.200 N Irf2 n/a
4 TRCN0000229582 GATCAAGAGATCGTCACTAAC pLKO_005 2077 CDS 100% 10.800 8.640 N Irf2 n/a
5 TRCN0000071475 CCTACGCAGAAAGCGAAACTA pLKO.1 2198 CDS 100% 5.625 4.500 N Irf2 n/a
6 TRCN0000218673 AGCCTTGACGATAGATTATTG pLKO_005 2677 3UTR 100% 13.200 9.240 N Irf2 n/a
7 TRCN0000229580 CATCAACCAGGAATAGATAAA pLKO_005 1705 CDS 100% 13.200 9.240 N Irf2 n/a
8 TRCN0000229583 CATCAAGAAGACATCTGATAT pLKO_005 2514 CDS 100% 13.200 9.240 N Irf2 n/a
9 TRCN0000071476 CCAGTGTCATCAAGAAGACAT pLKO.1 2507 CDS 100% 4.950 3.465 N Irf2 n/a
10 TRCN0000071473 CCAGGAATAGATAAACCAGAT pLKO.1 1711 CDS 100% 4.050 2.835 N Irf2 n/a
11 TRCN0000425704 TGCTTCTGCACCTTATCTTAA pLKO_005 2983 3UTR 100% 13.200 9.240 N IRF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312580.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00880 pDONR223 100% 83.7% 87.2% None (many diffs) n/a
2 ccsbBroad304_00880 pLX_304 0% 83.7% 87.2% V5 (many diffs) n/a
3 TRCN0000469585 GAGTATAACCTAGCCAACCTAAGC pLX_317 42.3% 83.7% 87.2% V5 (many diffs) n/a
4 TRCN0000491473 CCATTGTAACACCCAAATCCCGCA pLX_317 24.4% 83.7% 87.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV