Transcript: Human XM_024454035.1

PREDICTED: Homo sapiens interferon regulatory factor 2 (IRF2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IRF2 (3660)
Length:
3645
CDS:
1551..2600

Additional Resources:

NCBI RefSeq record:
XM_024454035.1
NBCI Gene record:
IRF2 (3660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014701 GCGGTCCTGACTTCAACTATA pLKO.1 2025 CDS 100% 13.200 18.480 N IRF2 n/a
2 TRCN0000429995 TGGATGCATGCGGCTAGACAT pLKO_005 1662 CDS 100% 4.950 6.930 N IRF2 n/a
3 TRCN0000418311 AGAAAGCGAAACGACTGATAG pLKO_005 2243 CDS 100% 10.800 8.640 N IRF2 n/a
4 TRCN0000423505 TAGAAACTGGGCAATCCATAC pLKO_005 1715 CDS 100% 6.000 4.800 N IRF2 n/a
5 TRCN0000423604 CAGAACGGCCTTCTAAGAAAG pLKO_005 1894 CDS 100% 10.800 7.560 N IRF2 n/a
6 TRCN0000432925 CCTTCGTCACTTCCAACAAAC pLKO_005 2386 CDS 100% 10.800 7.560 N IRF2 n/a
7 TRCN0000014699 CCAGACATTTGCCAAGTTGTA pLKO.1 2139 CDS 100% 4.950 3.465 N IRF2 n/a
8 TRCN0000014698 CGGACGAGATAATGTGAACTA pLKO.1 2921 3UTR 100% 4.950 3.465 N IRF2 n/a
9 TRCN0000014700 CCAGGAGTAGATAAACCTGAT pLKO.1 1749 CDS 100% 4.050 2.835 N IRF2 n/a
10 TRCN0000014702 GCAGATAAACTCCAACACGAT pLKO.1 1592 CDS 100% 2.640 1.848 N IRF2 n/a
11 TRCN0000428002 CAGTACTGGAGCTTCTCTTTA pLKO_005 2749 3UTR 100% 13.200 7.920 N IRF2 n/a
12 TRCN0000425704 TGCTTCTGCACCTTATCTTAA pLKO_005 3000 3UTR 100% 13.200 7.920 N IRF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00880 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00880 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469585 GAGTATAACCTAGCCAACCTAAGC pLX_317 42.3% 100% 100% V5 n/a
4 TRCN0000491473 CCATTGTAACACCCAAATCCCGCA pLX_317 24.4% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV