Transcript: Human XM_024454039.1

PREDICTED: Homo sapiens interferon regulatory factor 2 (IRF2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IRF2 (3660)
Length:
7110
CDS:
209..1093

Additional Resources:

NCBI RefSeq record:
XM_024454039.1
NBCI Gene record:
IRF2 (3660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454039.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429995 TGGATGCATGCGGCTAGACAT pLKO_005 320 CDS 100% 4.950 6.930 N IRF2 n/a
2 TRCN0000418311 AGAAAGCGAAACGACTGATAG pLKO_005 736 CDS 100% 10.800 8.640 N IRF2 n/a
3 TRCN0000423505 TAGAAACTGGGCAATCCATAC pLKO_005 373 CDS 100% 6.000 4.800 N IRF2 n/a
4 TRCN0000423604 CAGAACGGCCTTCTAAGAAAG pLKO_005 552 CDS 100% 10.800 7.560 N IRF2 n/a
5 TRCN0000432925 CCTTCGTCACTTCCAACAAAC pLKO_005 879 CDS 100% 10.800 7.560 N IRF2 n/a
6 TRCN0000014699 CCAGACATTTGCCAAGTTGTA pLKO.1 632 CDS 100% 4.950 3.465 N IRF2 n/a
7 TRCN0000014698 CGGACGAGATAATGTGAACTA pLKO.1 1414 3UTR 100% 4.950 3.465 N IRF2 n/a
8 TRCN0000014700 CCAGGAGTAGATAAACCTGAT pLKO.1 407 CDS 100% 4.050 2.835 N IRF2 n/a
9 TRCN0000014702 GCAGATAAACTCCAACACGAT pLKO.1 250 CDS 100% 2.640 1.848 N IRF2 n/a
10 TRCN0000428002 CAGTACTGGAGCTTCTCTTTA pLKO_005 1242 3UTR 100% 13.200 7.920 N IRF2 n/a
11 TRCN0000425704 TGCTTCTGCACCTTATCTTAA pLKO_005 1493 3UTR 100% 13.200 7.920 N IRF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454039.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00880 pDONR223 100% 84.2% 84.2% None 362_363ins165 n/a
2 ccsbBroad304_00880 pLX_304 0% 84.2% 84.2% V5 362_363ins165 n/a
3 TRCN0000469585 GAGTATAACCTAGCCAACCTAAGC pLX_317 42.3% 84.2% 84.2% V5 362_363ins165 n/a
4 TRCN0000491473 CCATTGTAACACCCAAATCCCGCA pLX_317 24.4% 84.2% 84.2% V5 (not translated due to prior stop codon) 362_363ins165 n/a
Download CSV