Construct: ORF TRCN0000469795
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008269.1_s317c1
- Derived from:
- ccsbBroadEn_11562
- DNA Barcode:
- TCAAAACACGGAAATGTGCTACGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CFHR3 (10878)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469795
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10878 | CFHR3 | complement factor H related 3 | NM_001166624.1 | 65.8% | 56.3% | (many diffs) |
| 2 | human | 10878 | CFHR3 | complement factor H related 3 | XR_241062.3 | 59.7% | (many diffs) | |
| 3 | human | 10878 | CFHR3 | complement factor H related 3 | NM_021023.5 | 58.4% | 56.6% | (many diffs) |
| 4 | human | 10878 | CFHR3 | complement factor H related 3 | XR_426757.2 | 52.7% | (many diffs) | |
| 5 | human | 10877 | CFHR4 | complement factor H related 4 | XM_017000113.1 | 38.5% | 29.4% | (many diffs) |
| 6 | human | 10877 | CFHR4 | complement factor H related 4 | XM_017000112.1 | 37.7% | 28.8% | (many diffs) |
| 7 | human | 10877 | CFHR4 | complement factor H related 4 | XM_017000111.1 | 34% | 26% | (many diffs) |
| 8 | human | 10877 | CFHR4 | complement factor H related 4 | XM_017000110.1 | 33.9% | 26% | (many diffs) |
| 9 | human | 10877 | CFHR4 | complement factor H related 4 | NM_006684.5 | 32.4% | 28.4% | (many diffs) |
| 10 | human | 10878 | CFHR3 | complement factor H related 3 | XR_001736938.1 | 32.4% | (many diffs) | |
| 11 | human | 10878 | CFHR3 | complement factor H related 3 | XR_002958987.1 | 32.1% | (many diffs) | |
| 12 | human | 10877 | CFHR4 | complement factor H related 4 | NM_001201551.2 | 30.6% | 23.3% | (many diffs) |
| 13 | human | 10877 | CFHR4 | complement factor H related 4 | NM_001201550.3 | 30.5% | 23.3% | (many diffs) |
| 14 | human | 10877 | CFHR4 | complement factor H related 4 | XM_006711129.3 | 29.3% | 22.1% | (many diffs) |
| 15 | human | 3075 | CFH | complement factor H | NM_001014975.2 | 27.5% | 22.9% | (many diffs) |
| 16 | human | 3075 | CFH | complement factor H | XM_017001108.2 | 27.3% | 22.9% | (many diffs) |
| 17 | human | 10878 | CFHR3 | complement factor H related 3 | XR_001736937.1 | 26.4% | (many diffs) | |
| 18 | human | 3075 | CFH | complement factor H | NM_000186.4 | 14.2% | 11.5% | (many diffs) |
| 19 | human | 3075 | CFH | complement factor H | XR_001737134.2 | 12.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 651
- ORF length:
- 585
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt gttactaatc aatgtcgttc tgaccttgtg ggtttcctgt gctaatggac 121 aagtgaaacc ttgtgatttt ccagacatta aacatggagg tctatttcat gagaatatgc 181 gtagaccata ctttccagta gctgtaggaa aatattactc ctattactgt gatgaacatt 241 ttgagactcc ttcaggaagt tactgggatt acattcattg cacacaaaat gggtggtcac 301 cagcagtacc atgtctcaga aaatgttatt ttccttattt ggaaaatgga tataatcaaa 361 attatggaag aaagtttgta cagggtaact ctacagaagt tgcctgccat cctggcTACG 421 GTCTTCCAAA AGCGCAGACC ACAGTTACAT GTACGGAGAA AGGCTGGTCT CCTACTCCCA 481 GATGCATCCG TGTCAGAACA TGCTCAAAAT CAGATATAGA AATTGAAAAT GGATTCATTT 541 CCGAATCTTC CTCTATTTAT ATTTTAAATA AAGAAATACA ATATAAATGT AAACCAGGAT 601 ATGCAACAGC AGATGGAAAT TCTTCATATA TGGTTTTTTG CATTTCTTAT TACCCAACTT 661 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 721 CTACGTAGTA ATGAACTAGT TCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 781 CTTGTGGAAA GGACGATCAA AACACGGAAA TGTGCTACGT ACGCGTTAAG TCgacaatca 841 acctctggat tacaaaattt gtgaaagatt