Transcript: Human NM_000186.4

Homo sapiens complement factor H (CFH), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-02
Taxon:
Homo sapiens (human)
Gene:
CFH (3075)
Length:
3962
CDS:
76..3771

Additional Resources:

NCBI RefSeq record:
NM_000186.4
NBCI Gene record:
CFH (3075)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000186.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371726 TCTAATGAAGGGACCTAATAA pLKO_005 2064 CDS 100% 15.000 21.000 N CFH n/a
2 TRCN0000057136 GCTCTTAATCCATTAAGGAAA pLKO.1 292 CDS 100% 0.495 0.693 N CFH n/a
3 TRCN0000057133 CGCAAGAAAGACCAGTATAAA pLKO.1 1819 CDS 100% 15.000 12.000 N CFH n/a
4 TRCN0000057134 GCCAGTAATGTAACATGCATT pLKO.1 3154 CDS 100% 4.950 3.960 N CFH n/a
5 TRCN0000371774 TACTCACCTTTAAGGATTAAA pLKO_005 904 CDS 100% 15.000 10.500 N CFH n/a
6 TRCN0000377700 TTATGCACATGGGACTAAATT pLKO_005 2745 CDS 100% 15.000 10.500 N CFH n/a
7 TRCN0000057137 GCTCCGAGATGTACCTTGAAA pLKO.1 1024 CDS 100% 5.625 3.938 N CFH n/a
8 TRCN0000057135 CCTGAGATTTCTCATGGTGTT pLKO.1 2878 CDS 100% 4.050 2.835 N CFH n/a
9 TRCN0000161692 GTGTCGAGACAGATGAGTAAA pLKO.1 3253 CDS 100% 13.200 7.920 N CFHR1 n/a
10 TRCN0000159447 GTGAGAGAGTACGTTATCAAT pLKO.1 3284 CDS 100% 5.625 3.375 N CFHR1 n/a
11 TRCN0000159770 GATGAAGAAGTGATGTGTTTA pLKO.1 3331 CDS 100% 13.200 6.600 Y CFHR1 n/a
12 TRCN0000162296 CTTGAGGGTAACAAGCGAATA pLKO.1 3505 CDS 100% 10.800 5.400 Y CFHR1 n/a
13 TRCN0000160270 CCTATTACTGTGATGAACATT pLKO.1 1136 CDS 100% 5.625 2.813 Y CFHR3 n/a
14 TRCN0000161806 CGTGTGTAATATCCCGAGAAA pLKO.1 3572 CDS 100% 4.950 2.475 Y CFHR1 n/a
15 TRCN0000159479 CTTCATCAGTTGAGTACCAAT pLKO.1 3467 CDS 100% 4.950 2.475 Y CFHR1 n/a
16 TRCN0000162111 CGTAGACCATACTTTCCAGTA pLKO.1 1096 CDS 100% 4.050 2.025 Y CFHR3 n/a
17 TRCN0000163846 CGTCAGGAAGTTACTGGGATT pLKO.1 1166 CDS 100% 4.050 2.430 N CFHR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000186.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06361 pDONR223 100% 36.2% 36% None (many diffs) n/a
2 ccsbBroad304_06361 pLX_304 0% 36.2% 36% V5 (many diffs) n/a
3 TRCN0000492032 TTGACTGCTTACAACATTAGGGGG pLX_317 29% 36.2% 36% V5 (many diffs) n/a
4 ccsbBroadEn_11563 pDONR223 100% 16.5% 12.9% None (many diffs) n/a
5 ccsbBroad304_11563 pLX_304 0% 16.5% 12.9% V5 (many diffs) n/a
6 TRCN0000480539 CTATGAAGGAACCGGTGGGAACCC pLX_317 51.6% 16.5% 12.9% V5 (many diffs) n/a
7 ccsbBroadEn_11562 pDONR223 100% 14.2% 11.5% None (many diffs) n/a
8 ccsbBroad304_11562 pLX_304 0% 14.2% 11.5% V5 (many diffs) n/a
9 TRCN0000469795 TCAAAACACGGAAATGTGCTACGT pLX_317 40.4% 14.2% 11.5% V5 (many diffs) n/a
Download CSV