Construct: ORF TRCN0000469799
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018226.1_s317c1
- Derived from:
- ccsbBroadEn_12070
- DNA Barcode:
- AATAAGCACCCACAGGTGGCTTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WDR74 (54663)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469799
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 54663 | WDR74 | WD repeat domain 74 | NM_001307977.1 | 99.9% | 100% | 501G>T |
2 | human | 54663 | WDR74 | WD repeat domain 74 | NM_001369450.1 | 94.9% | 95% | 501G>T;920_976del |
3 | human | 54663 | WDR74 | WD repeat domain 74 | NM_001369451.1 | 94.9% | 95% | 501G>T;920_976del |
4 | human | 54663 | WDR74 | WD repeat domain 74 | NM_001369453.1 | 94.9% | 95% | 501G>T;920_976del |
5 | human | 54663 | WDR74 | WD repeat domain 74 | NM_018093.3 | 94.9% | 95% | 501G>T;920_976del |
6 | human | 54663 | WDR74 | WD repeat domain 74 | NM_001369447.1 | 91.6% | 91.7% | 370_411del;543G>T;962_1018del |
7 | human | 54663 | WDR74 | WD repeat domain 74 | NR_161381.1 | 89.7% | (many diffs) | |
8 | human | 54663 | WDR74 | WD repeat domain 74 | NM_001369448.1 | 59.9% | 60% | 0_1ins405;96G>T;515_571del |
9 | human | 54663 | WDR74 | WD repeat domain 74 | NM_001369449.1 | 59.9% | 60% | 0_1ins405;96G>T;515_571del |
10 | mouse | 107071 | Wdr74 | WD repeat domain 74 | NM_134139.1 | 81.6% | 84.4% | (many diffs) |
11 | mouse | 107071 | Wdr74 | WD repeat domain 74 | XM_006526554.3 | 52.5% | 55.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1164
- ORF length:
- 1098
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggctgctgct gcacgctgga accatgtgtg ggtcggcacc gagactggga 121 tcttgaaagg ggtaaatctt cagcgaaaac aggcggcgaa cttcacggcc ggaggacagc 181 cgcggcgcga ggaggcagtg agcgccctgt gttggggcac cggcggcgag acccagatgc 241 tggtgggctg cgcggacagg acggtgaagc acttcagcac cgaggatggc atattccagg 301 gtcagagaca ctgcccgggc ggggagggca tgttccgtgg cctcgcccag gccgacggca 361 ccctcatcac atgtgtggat tctgggattc tcagagtctg gcatgacaag gacaaggaca 421 catcctctga cccactcctg gaactgagag tgggccctgg ggtgtgtagg atgcgccaag 481 acccagcaca cccccatgtg gttgccacag gtgggaaaga gaatgctttg aagatatggg 541 acctgcaggg ctctgaggaa cctgttttca gggccaagaa cgtgcggaat gactggctgg 601 acttgcgggt tcccatctgg gaccaggaca tacagtttct cccaggatca cagaagcttg 661 tcacctgcac agggtaccac caggtccgtg tttatgatcc agcatccccc cagcgccggC 721 CAGTCCTAGA GACCACCTAT GGAGAGTACC CACTAACAGC CATGACCCTC ACTCCGGGAG 781 GCAACTCAGT GATTGTGGGA AACACTCATG GGCAGCTGGC AGAAATTGAC CTTCGGCAAG 841 GGCGTCTACT GGGCTGTCTG AAGGGGCTGG CAGGCAGTGT GCGTGGGTTG CAGTGCCACC 901 CTTCAAAGCC TCTACTAGCC TCCTGTGGCT TGGACAGAGT CTTGAGGATA CACAGGATCC 961 AGAATCCACG GGGTCTGGAG CATAAGGATG AGCCCCAAGA GCCTCAAGAA CCCAACAAGG 1021 TGCCCCTAGA AGACACAGAG ACAGATGAAC TTTGGGCATC CTTGGAGGCA GCTGCCAAGC 1081 GGAAGCTCTC GGGTTTGGAG CAGCCCCAAG GAGCTCTCCA AACGAGACGG AGAAAGAAGA 1141 AGCGGCCTGG GTCCACCAGC CCCTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1201 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1261 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA ATAAGCACCC 1321 ACAGGTGGCT TGCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1381 att