Transcript: Mouse NM_134139.1

Mus musculus WD repeat domain 74 (Wdr74), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Wdr74 (107071)
Length:
1220
CDS:
4..1158

Additional Resources:

NCBI RefSeq record:
NM_134139.1
NBCI Gene record:
Wdr74 (107071)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307566 GCGGAAACATGCGGCAAATTT pLKO_005 81 CDS 100% 15.000 21.000 N Wdr74 n/a
2 TRCN0000295469 ACAGAACCGTGAGGTACTTTA pLKO_005 194 CDS 100% 13.200 10.560 N Wdr74 n/a
3 TRCN0000124372 CGAGTTCCTATTTGGGACCAA pLKO.1 544 CDS 100% 2.640 2.112 N Wdr74 n/a
4 TRCN0000124373 GCTAGAGCATAAGGTTTATCT pLKO.1 912 CDS 100% 5.625 3.938 N Wdr74 n/a
5 TRCN0000288095 GCTAGAGCATAAGGTTTATCT pLKO_005 912 CDS 100% 5.625 3.938 N Wdr74 n/a
6 TRCN0000124370 CCCTTATCACATGTGTGGATT pLKO.1 299 CDS 100% 4.950 3.465 N Wdr74 n/a
7 TRCN0000288096 CCCTTATCACATGTGTGGATT pLKO_005 299 CDS 100% 4.950 3.465 N Wdr74 n/a
8 TRCN0000136220 GACACAGAGACAGATGAACTT pLKO.1 1027 CDS 100% 4.950 3.465 N WDR74 n/a
9 TRCN0000124369 GCTTTGAAAGTATGGGACCTA pLKO.1 463 CDS 100% 2.640 1.848 N Wdr74 n/a
10 TRCN0000124371 CCCAACCAAGTACCCTCAGAA pLKO.1 1006 CDS 100% 4.950 2.970 N Wdr74 n/a
11 TRCN0000288161 CCCAACCAAGTACCCTCAGAA pLKO_005 1006 CDS 100% 4.950 2.970 N Wdr74 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12070 pDONR223 100% 81.6% 84.4% None (many diffs) n/a
2 ccsbBroad304_12070 pLX_304 0% 81.6% 84.4% V5 (many diffs) n/a
3 TRCN0000469799 AATAAGCACCCACAGGTGGCTTGC pLX_317 40.6% 81.6% 84.4% V5 (many diffs) n/a
Download CSV