Construct: ORF TRCN0000469822
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006412.1_s317c1
- Derived from:
- ccsbBroadEn_01494
- DNA Barcode:
- CTTTCGACTTTATCAGCAGGCCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SCP2 (6342)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469822
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 6342 | SCP2 | sterol carrier protein 2 | NM_001007098.2 | 100% | 100% | |
2 | human | 6342 | SCP2 | sterol carrier protein 2 | NM_001330587.1 | 87.9% | 87.9% | 198_329del |
3 | human | 6342 | SCP2 | sterol carrier protein 2 | XM_011541935.2 | 78.7% | 79.4% | 198_329del;1082_1083insAGGACATTCCTGC;1086_1197del |
4 | human | 6342 | SCP2 | sterol carrier protein 2 | XM_005271103.4 | 68.5% | 68.6% | (many diffs) |
5 | human | 6342 | SCP2 | sterol carrier protein 2 | NM_001193600.2 | 63.1% | 63.2% | 950_951insAGGACAT;953T>C;959_1509delinsT |
6 | human | 6342 | SCP2 | sterol carrier protein 2 | NM_001193599.2 | 59% | 57.5% | (many diffs) |
7 | human | 6342 | SCP2 | sterol carrier protein 2 | NM_002979.5 | 58% | 58.1% | (many diffs) |
8 | human | 6342 | SCP2 | sterol carrier protein 2 | NM_001193617.2 | 53.4% | 50% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1032
- ORF length:
- 966
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ctcttccccg tgggagcctg cgaccctgcg ccgggtgttc gtggtggggg 121 ttggcatgac caagtttgtg aagcctggag ctgagaattc aagagactac cctgacttgg 181 cagaagaagc aggcaagaag gctttagctg atgcacagat cccttattca gcagtggacc 241 aggcatgtgt tggctatgtt tttggtgtgg cagaatgtgt cttggctctt gggtttgaga 301 agatgagtaa gggaagcctt ggaataaaat tttcagatag aaccattccc actgataagc 361 atgttgacct cctgatcaat aagtatggat tgtctgctca cccagttgct cctcagatgt 421 ttgggtatgc tggaaaagaa catatggaaa aatatggaac aaaaattgaa cactttgcaa 481 aaattggatg gaaaaatcat aaacattcag ttaataaccc gtattcccag ttccaagatg 541 aatacagttt agatgaagtg atggcatcta aagaagtttt tgattttttg actatcttac 601 aatgttgtcc cacttcagat ggtgctgcag cagcaatttt ggccagtgaa gcatttGTAC 661 AGAAGTATGG CCTGCAATCC AAAGCTGTGG AAATTTTGGC ACAAGAAATG ATGACTGATT 721 TGCCAAGCTC GTTTGAAGAA AAAAGCATTA TTAAAATGGT TGGCTTTGAT ATGAGTAAAG 781 AAGCTGCAAG AAAATGCTAT GAGAAATCTG GCCTGACACC AAATGATATT GACGTAATAG 841 AACTTCACGA TTGCTTTTCT ACCAACGAAC TCCTTACTTA TGAAGCACTG GGACTCTGTC 901 CAGAAGGACA AGGTGCAACG CTGGTTGATA GAGGAGATAA TACATATGGA GGAAAGTGGG 961 TCATAAATCC TAGTGGTGGA CTGATTTCAA AGGGACACCC ACTAGGCGCT ACAGGAGGAC 1021 ATTCCTGCTC TTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1081 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1141 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACTT TCGACTTTAT CAGCAGGCCC 1201 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t