Transcript: Human XM_005271103.4

PREDICTED: Homo sapiens sterol carrier protein 2 (SCP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCP2 (6342)
Length:
2532
CDS:
112..1503

Additional Resources:

NCBI RefSeq record:
XM_005271103.4
NBCI Gene record:
SCP2 (6342)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271103.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147400 GTCTCGCTATGAAGTTACAAA pLKO.1 1570 3UTR 100% 5.625 7.875 N SCP2 n/a
2 TRCN0000343448 GTCTCGCTATGAAGTTACAAA pLKO_005 1570 3UTR 100% 5.625 7.875 N SCP2 n/a
3 TRCN0000149861 GCTCTGCAAGTGATGGATTTA pLKO.1 1385 CDS 100% 13.200 10.560 N SCP2 n/a
4 TRCN0000149883 GCAATCCAAAGCTGTGGAAAT pLKO.1 852 CDS 100% 10.800 7.560 N SCP2 n/a
5 TRCN0000352916 GCAATCCAAAGCTGTGGAAAT pLKO_005 852 CDS 100% 10.800 7.560 N SCP2 n/a
6 TRCN0000148447 CCTGGCTTTAATGACTGGTAA pLKO.1 1493 CDS 100% 4.950 3.465 N SCP2 n/a
7 TRCN0000343447 CCTGGCTTTAATGACTGGTAA pLKO_005 1493 CDS 100% 4.950 3.465 N SCP2 n/a
8 TRCN0000146526 GAGGGCTATCTATCACAGTTT pLKO.1 330 CDS 100% 4.950 3.465 N SCP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271103.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01494 pDONR223 100% 68.5% 68.6% None (many diffs) n/a
2 ccsbBroad304_01494 pLX_304 0% 68.5% 68.6% V5 (many diffs) n/a
3 TRCN0000469822 CTTTCGACTTTATCAGCAGGCCCT pLX_317 39.1% 68.5% 68.6% V5 (many diffs) n/a
Download CSV