Transcript: Human NM_001193600.2

Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SCP2 (6342)
Length:
2627
CDS:
122..1633

Additional Resources:

NCBI RefSeq record:
NM_001193600.2
NBCI Gene record:
SCP2 (6342)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193600.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147400 GTCTCGCTATGAAGTTACAAA pLKO.1 1578 CDS 100% 5.625 7.875 N SCP2 n/a
2 TRCN0000343448 GTCTCGCTATGAAGTTACAAA pLKO_005 1578 CDS 100% 5.625 7.875 N SCP2 n/a
3 TRCN0000149861 GCTCTGCAAGTGATGGATTTA pLKO.1 1263 CDS 100% 13.200 10.560 N SCP2 n/a
4 TRCN0000149883 GCAATCCAAAGCTGTGGAAAT pLKO.1 730 CDS 100% 10.800 7.560 N SCP2 n/a
5 TRCN0000352916 GCAATCCAAAGCTGTGGAAAT pLKO_005 730 CDS 100% 10.800 7.560 N SCP2 n/a
6 TRCN0000148447 CCTGGCTTTAATGACTGGTAA pLKO.1 1501 CDS 100% 4.950 3.465 N SCP2 n/a
7 TRCN0000343447 CCTGGCTTTAATGACTGGTAA pLKO_005 1501 CDS 100% 4.950 3.465 N SCP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193600.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01494 pDONR223 100% 63.1% 63.2% None 950_951insAGGACAT;953T>C;959_1509delinsT n/a
2 ccsbBroad304_01494 pLX_304 0% 63.1% 63.2% V5 950_951insAGGACAT;953T>C;959_1509delinsT n/a
3 TRCN0000469822 CTTTCGACTTTATCAGCAGGCCCT pLX_317 39.1% 63.1% 63.2% V5 950_951insAGGACAT;953T>C;959_1509delinsT n/a
4 ccsbBroadEn_06916 pDONR223 100% 28.3% 28.2% None 1_1080del;1502C>G n/a
5 ccsbBroad304_06916 pLX_304 0% 28.3% 28.2% V5 (not translated due to frame shift) 1_1080del;1502C>G n/a
Download CSV