Construct: ORF TRCN0000469870
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008281.1_s317c1
- Derived from:
- ccsbBroadEn_09303
- DNA Barcode:
- ATGCAGCGACCTAGGTCATCTGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRSAM1 (90678)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469870
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 90678 | LRSAM1 | leucine rich repeat and ste... | NM_001005373.3 | 99.9% | 99.8% | 249C>T;952A>G |
| 2 | human | 90678 | LRSAM1 | leucine rich repeat and ste... | NM_001005374.3 | 99.9% | 99.8% | 249C>T;952A>G |
| 3 | human | 90678 | LRSAM1 | leucine rich repeat and ste... | NM_138361.5 | 99.9% | 99.8% | 249C>T;952A>G |
| 4 | human | 90678 | LRSAM1 | leucine rich repeat and ste... | XM_017015283.1 | 99.9% | 99.8% | 249C>T;952A>G |
| 5 | human | 90678 | LRSAM1 | leucine rich repeat and ste... | NM_001190723.3 | 96.1% | 96.1% | 249C>T;952A>G;1418_1419ins81 |
| 6 | human | 90678 | LRSAM1 | leucine rich repeat and ste... | XM_006717316.4 | 95.3% | 95.2% | 249C>T;952A>G;1599_1600ins99 |
| 7 | human | 90678 | LRSAM1 | leucine rich repeat and ste... | XR_929874.3 | 69.1% | (many diffs) | |
| 8 | human | 90678 | LRSAM1 | leucine rich repeat and ste... | XR_001746415.2 | 65.5% | (many diffs) | |
| 9 | human | 90678 | LRSAM1 | leucine rich repeat and ste... | XM_017015284.2 | 63.5% | 63.4% | 0_1ins789;163A>G |
| 10 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | NM_199302.2 | 85.7% | 87.6% | (many diffs) |
| 11 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XM_006497969.3 | 85.7% | 87.6% | (many diffs) |
| 12 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XM_006497970.3 | 85.7% | 87.6% | (many diffs) |
| 13 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XM_006497971.3 | 85.7% | 87.6% | (many diffs) |
| 14 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XM_006497972.3 | 85.7% | 87.6% | (many diffs) |
| 15 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XM_006497962.3 | 82.2% | 84% | (many diffs) |
| 16 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XM_006497963.3 | 82.2% | 84% | (many diffs) |
| 17 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XM_006497964.3 | 82.2% | 84% | (many diffs) |
| 18 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XM_006497965.3 | 82.2% | 84% | (many diffs) |
| 19 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XM_006497966.3 | 82.2% | 84% | (many diffs) |
| 20 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XM_006497967.3 | 79.8% | 81.5% | (many diffs) |
| 21 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XM_006497968.3 | 78.9% | 80.7% | (many diffs) |
| 22 | mouse | 227738 | Lrsam1 | leucine rich repeat and ste... | XR_374086.2 | 54.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2235
- ORF length:
- 2169
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gctcttcttc cggaagcgga aacccagtga ggaggctcgg aaacgcctgg 121 agtaccagat gtgtttggca aaagaagctg gggcagatga cattctcgac atctctaaat 181 gtgagctctc agagattcca tttggagctt ttgcaacatg caaagttctg cagaagaagg 241 tgctgatcgt ccacacgaat cacctcactt ccctgcttcc caaatcctgc agcctcctga 301 gtctggcaac cattaaggtt ctagatctcc acgataatca gctgacagcc cttcctgacg 361 atctggggca gctgactgcc ctccaggtct taaacgtgga aaggaatcaa ctgatgcagc 421 tcccacgttc cattgggaac ctgacccagc tccagactct caatgttaaa gacaacaagc 481 tgaaggagct tccagacacc gtgggggagc ttcgaagcct gcgtaccctc aacatcagtg 541 gaaacgagat ccagagattg ccgcagatgc tggctcacgt tcgaaccctg gagatgctga 601 gccttgacgc ctcggccatg gtctacccgc cgcgggaggt gtgtggtgcc ggcactgcgg 661 ccatcttgca gttcctctgc aaagagtcag ggctggaata ctacccccct tctcagtact 721 tgctgccaat tctggagcaa gatggaatcg agaactctcg ggacagccct gatgggccca 781 cggacagatt ctcaagggag gagttagagt ggcagaacag gttctcagac tatgagaaga 841 ggaaggaaca gaagatgctg gagaaactcg agtttgaacg gcgcctggaa ctggggcagc 901 gggagcacac ccagctcctt cagcagagca gcagccagaa ggatgagatc cttcagacgg 961 tcaaggagga gcagtcccgg ctggagcagg gcctgagtga gcaccagcgc cacctcgacg 1021 cagagcggca gcggctgcag gagcagctga agcagacgga acagaacatt tccagccgga 1081 tccagaagct gctgcaggac aatcagagac aaaagaaaag ctccgagatt ttgaaatcgc 1141 tggaaaatga aagaataaga atggaacagt tgatgtccat aacccaggag gagactgaga 1201 gcctgcggcg acgtgacgtt gcctccgcca tgcagcagat gctgactgag agctgtaaga 1261 accggctcat ccagatggcc tacgaatctc agaggcagaa cttggtccag caggcctgtt 1321 ccagcatggc cgaaatggat gaacgattcc agcagattct gtcgtggcag caaatggatc 1381 agaacaaagc catcagccag atcctgcagg agagcgcgat gcagaaggct gcgttcgagg 1441 cactccaggt gaagaaagac ctgatgcatc ggcagatcag gagccagatt aagttaatag 1501 aaactgagtt attgcagctg acacagctgg agttaaagag gaagtccctg gacacagagt 1561 cactccagga gatgatctcg gagcagcgct gggccctcag ctccctgctc cagcagctgc 1621 tcaaagagaa gcagcagcga gaggaagagc tccgggaaat cctgacggag ttagaagcca 1681 aaagtgaaac caggcaggaa aattactggc tgattcagta tcaacggctt ttgaaccaga 1741 agcccttgtc cttgaagctg caagaagagg ggatggagcg ccagctggtg gccctcctgg 1801 aggagctgtc ggctgagcac tacctgccca tctttgcgca ccaccgcctc tcactggacc 1861 tgcTGAGCCA AATGAGCCCA GGGGACCTGG CCAAGGTGGG CGTCTCAGAA GCTGGCCTGC 1921 AGCACGAGAT CCTCCGGAGA GTCCAGGAAC TGCTGGATGC AGCCAGGATC CAGCCAGAGC 1981 TGAAACCACC AATGGGTGAG GTCGTCACCC CTACGGCCCC CCAGGAGCCT CCTGAGTCTG 2041 TGAGGCCATC CGCTCCCCCT GCAGAGCTGG AGGTGCAGGC CTCAGAGTGT GTCGTGTGCC 2101 TGGAACGGGA GGCCCAGATG ATCTTCCTCA ACTGTGGCCA CGTCTGCTGC TGCCAGCAGT 2161 GCTGCCAGCC ACTGCGCACC TGCCCGCTGT GCCGCCAGGA CATCGCCCAG CGCCTCCGCA 2221 TCTACCACAG CAGCTCCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 2281 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 2341 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA ATGCAGCGAC CTAGGTCATC 2401 TGGAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt