Transcript: Human NM_001005373.3

Homo sapiens leucine rich repeat and sterile alpha motif containing 1 (LRSAM1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
LRSAM1 (90678)
Length:
3146
CDS:
373..2544

Additional Resources:

NCBI RefSeq record:
NM_001005373.3
NBCI Gene record:
LRSAM1 (90678)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073154 GCAACCATCAAGGTTCTAGAT pLKO.1 613 CDS 100% 4.950 6.930 N LRSAM1 n/a
2 TRCN0000426738 GAGCTCTCAGAGATTCCATTT pLKO_005 490 CDS 100% 10.800 8.640 N LRSAM1 n/a
3 TRCN0000073157 TGATTCAGTATCAACGGCTTT pLKO.1 2018 CDS 100% 4.050 3.240 N LRSAM1 n/a
4 TRCN0000425998 GACATTCTCGACATCTCTAAA pLKO_005 466 CDS 100% 13.200 9.240 N LRSAM1 n/a
5 TRCN0000417033 TCCAGACTCTCAATGTTAAAG pLKO_005 758 CDS 100% 13.200 9.240 N LRSAM1 n/a
6 TRCN0000073156 CGTGGAAAGGAATCAACTGAT pLKO.1 702 CDS 100% 4.950 3.465 N LRSAM1 n/a
7 TRCN0000073155 GATGAACGATTCCAGCAGATT pLKO.1 1645 CDS 100% 4.950 3.465 N LRSAM1 n/a
8 TRCN0000073153 GCAGATCAGGAGCCAGATTAA pLKO.1 1779 CDS 100% 13.200 7.920 N LRSAM1 n/a
9 TRCN0000430112 GGGAAATCCTGACGGAGTTAG pLKO_005 1961 CDS 100% 10.800 6.480 N LRSAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09303 pDONR223 100% 99.9% 99.8% None 249C>T;952A>G n/a
2 ccsbBroad304_09303 pLX_304 0% 99.9% 99.8% V5 249C>T;952A>G n/a
3 TRCN0000469870 ATGCAGCGACCTAGGTCATCTGGA pLX_317 17.4% 99.9% 99.8% V5 249C>T;952A>G n/a
Download CSV