Construct: ORF TRCN0000469887
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014849.1_s317c1
- Derived from:
- ccsbBroadEn_01715
- DNA Barcode:
- TTGCTATCGAGTTAACGCTTCTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TRPC4 (7223)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469887
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7223 | TRPC4 | transient receptor potentia... | NM_016179.4 | 100% | 100% | |
| 2 | human | 7223 | TRPC4 | transient receptor potentia... | NM_003306.3 | 99.4% | 99.4% | 2080_2094del |
| 3 | human | 7223 | TRPC4 | transient receptor potentia... | NM_001135955.3 | 91.4% | 91.4% | 2351_2352ins252 |
| 4 | human | 7223 | TRPC4 | transient receptor potentia... | NM_001135957.3 | 85.5% | 85.5% | 2181_2182ins423 |
| 5 | human | 7223 | TRPC4 | transient receptor potentia... | NM_001135956.3 | 84.7% | 84.7% | 1884_1885ins195;2156_2157ins252 |
| 6 | human | 7223 | TRPC4 | transient receptor potentia... | NM_001135958.3 | 82.2% | 82.2% | 376_377ins519 |
| 7 | human | 7223 | TRPC4 | transient receptor potentia... | NM_001354799.2 | 57% | 57% | 0_1ins1260 |
| 8 | human | 7223 | TRPC4 | transient receptor potentia... | NM_001354806.2 | 57% | 57% | 0_1ins1260 |
| 9 | human | 7223 | TRPC4 | transient receptor potentia... | NM_001372055.1 | 57% | 57% | 0_1ins1260 |
| 10 | human | 7223 | TRPC4 | transient receptor potentia... | XM_011535206.1 | 56.7% | 56.7% | 0_1ins1260;820_834del |
| 11 | human | 7223 | TRPC4 | transient receptor potentia... | XM_017020723.1 | 56.7% | 56.7% | 0_1ins1260;820_834del |
| 12 | mouse | 22066 | Trpc4 | transient receptor potentia... | NM_016984.3 | 87.9% | 96.8% | (many diffs) |
| 13 | mouse | 22066 | Trpc4 | transient receptor potentia... | XM_006501296.3 | 87.9% | 96.8% | (many diffs) |
| 14 | mouse | 22066 | Trpc4 | transient receptor potentia... | NM_001253682.1 | 80.1% | 88.7% | (many diffs) |
| 15 | mouse | 22066 | Trpc4 | transient receptor potentia... | XM_017319534.1 | 80.1% | 88.6% | (many diffs) |
| 16 | mouse | 22066 | Trpc4 | transient receptor potentia... | NR_046161.1 | 72.1% | (many diffs) | |
| 17 | mouse | 22066 | Trpc4 | transient receptor potentia... | XM_006501297.3 | 49.7% | 53.8% | (many diffs) |
| 18 | mouse | 22066 | Trpc4 | transient receptor potentia... | XM_006501298.1 | 49.7% | 53.8% | (many diffs) |
| 19 | mouse | 22066 | Trpc4 | transient receptor potentia... | NM_001253683.1 | 38.8% | 41.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 3000
- ORF length:
- 2931
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctcagttc tattacaaaa gaaatgttaa tgctccctat agagaccgca 121 tccctctaag gatagtaaga gcagaatcag aactctcgcc atcagaaaaa gcctacttga 181 atgctgtgga aaagggagat tatgccagtg tcaagaaatc cctagaggaa gctgaaattt 241 attttaaaat caatattaat tgcattgatc ctctcggaag aactgctctc ctcattgcaa 301 ttgaaaatga gaacttggag ctcatcgaac tactcttaag ctttaatgtc tatgttggag 361 atgctctatt acatgctatc agaaaagaag tcgtcggagc tgttgagctg ttattgaacc 421 acaaaaaacc tagtggagaa aaacaggtgc ctcctatact ccttgataag cagttctctg 481 aattcactcc agacattaca ccaatcattt tggcagccca tacaaataat tatgagataa 541 taaaactctt ggttcagaaa ggagtctcag tgcctcgacc ccacgaggtc cgctgtaact 601 gtgtggaatg cgtgtccagt tcagatgtgg acagcctccg tcactcacgc tccagactca 661 acatctacaa ggccttggcc agtccctctc tcattgcact gtcaagcgaa gatccttttc 721 tcacagcctt tcagttaagt tgggaacttc aggaactgag caaggtggaa aatgaattca 781 agtcggagta tgaagagctg tcacggcagt gcaaacaatt tgctaaggac ctactggatc 841 agacgagaag ttccagagaa ctggaaatca ttcttaatta ccgagatgac aatagtctca 901 tagaagaaca aagtggaaat gatcttgcaa gactaaaatt ggccattaag taccgtcaaa 961 aagagtttgt tgcccagccc aattgtcaac agctgctggc atctcgctgg tacgatgagt 1021 ttccaggctg gaggagaaga cactgggcag tgaagatggt gacatgtttc ataataggac 1081 ttctttttcc tgtcttctct gtgtgctacc tgatagctcc caaaagccca cttggactgt 1141 tcatcaggaa gccatttatc aagtttatct gccacacagc ctcctatttg acttttttgt 1201 tcctgctgct gcttgcctct cagcacatcg acaggtcaga cttgaacagg caaggtccac 1261 caccaaccat cgtcgagtgg atgatattac cgtgggtcct gggcttcata tggggagaaa 1321 ttaaacagat gtgggatggc ggacttcagg actacatcca tgattggtgg aatctaatgg 1381 actttgtaat gaactcctta tatttagcaa caatctcctt gaaaattgtt gcatttgtaa 1441 agtacagtgc ccttaatcca cgagaatcat gggacatgtg gcatcccact ctggtggcag 1501 aggctttatt tgctattgca aacatcttca gttctctgcg tctgatctca ctgtttactg 1561 caaattctca cctgggacct ctgcaaatat ctctgggaag aatgctcctg gacattttga 1621 agtttctatt catatactgc cttgtgttgc tagcatttgc aaatggccta aatcaattgt 1681 acttctatta tgaagaaacg aaagggttaa cctgcaaagg cataagatgt gaaaagcaga 1741 ataatgcatt ttcaacgtta tttgagacac tgcagtccct gttttggtca atatttgggc 1801 tcatcaattt atatgtgacc aatgtcaaag cacagcatga atttactgag tttgttggtg 1861 ccaccatgtt tgggacatac aatgtcatct ctctggttgt tctactcaac atgttaatag 1921 ctatgatgaa taattcttac caactgattg ctgaccatgc agatatagaa tggaaatttg 1981 cacgaacaaa gctttggatg agttattttg aagaaggagg tactctgcct actcccttca 2041 atgtcatccc gagccccaag tctctctggt acctgatcaa atggatctgg acacacttgt 2101 gcaagaaaaa gatgagaaga aagccagaaa gttttggaac aatagggagg cgagctgctg 2161 ataacttgag aagacatcac caataccaag aagttatgag gaacctggtg aagcgatacg 2221 ttgctgcaat gattagagat gctaaaactg aagaaggcct gaccgaagag aactttaagg 2281 aactaaagca agacatttct agtttccgct ttgaagtcct gggattacta agaggaagca 2341 aactttccac aatacaatct gcgaatgcct cgaaggagtc ttcaaattcg gcagactcag 2401 atgaaaagag tgatagcgaa ggtaatagca aggacaagaa aaagaatttc agcctttttg 2461 atttaaccac cctgattcat ccgagatcag cagcaattgc ctctgaaaga cataacataa 2521 gcaatggctc tgccctggtg gttcaggagc cgcccaggga gaagcagaga aaagtgaatt 2581 ttgtgaccga tatcaaaaac tttgggttat ttcatagacg atcaaaacaa aatgctgctg 2641 agcaaaatgc aaaccaaatc ttctctgttt cagaagaagt tgctcgtcaa caggctgcag 2701 gacCACTTGA GAGAAATATT CAACTGGAAT CTCGAGGATT AGCTTCACGG GGTGACCTGA 2761 GCATTCCCGG TCTCAGTGAA CAATGTGTGT TAGTAGACCA TAGAGAAAGG AATACGGACA 2821 CACTGGGGTT ACAGGTAGGA AAGAGAGTGT GTCCATTCAA GTCAGAGAAG GTGGTGGTGG 2881 AGGACACGGT TCCTATAATA CCAAAGGAGA AACATGCAAA AGAAGAGGAC TCTAGTATAG 2941 ACTATGATCT AAACCTCCCA GACACAGTCA CCCACGAAGA TTACGTGACC ACAAGATTGT 3001 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 3061 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 3121 TTTATATATC TTGTGGAAAG GACGATTGCT ATCGAGTTAA CGCTTCTCGA CGCGTTAAGT 3181 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt