Transcript: Human NM_001354799.2

Homo sapiens transient receptor potential cation channel subfamily C member 4 (TRPC4), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TRPC4 (7223)
Length:
7968
CDS:
1455..3128

Additional Resources:

NCBI RefSeq record:
NM_001354799.2
NBCI Gene record:
TRPC4 (7223)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354799.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044046 GCATCCCTCTAAGGATAGTAA pLKO.1 255 5UTR 100% 5.625 7.875 N TRPC4 n/a
2 TRCN0000044047 CGAAGGTAATAGCAAGGACAA pLKO.1 2543 CDS 100% 4.050 5.670 N TRPC4 n/a
3 TRCN0000068324 GCTGATAACTTGAGAAGACAT pLKO.1 2283 CDS 100% 4.950 3.960 N Trpc4 n/a
4 TRCN0000044043 GCCTCCTATACTCCTTGATAA pLKO.1 586 5UTR 100% 13.200 9.240 N TRPC4 n/a
5 TRCN0000417470 TTACCATACACATACGTATTT pLKO_005 3148 3UTR 100% 13.200 9.240 N TRPC4 n/a
6 TRCN0000044044 CGAGATGACAATAGTCTCATA pLKO.1 1019 5UTR 100% 4.950 3.465 N TRPC4 n/a
7 TRCN0000044045 GCAAAGGCATAAGATGTGAAA pLKO.1 1840 CDS 100% 4.950 3.465 N TRPC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354799.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01715 pDONR223 100% 57% 57% None 0_1ins1260 n/a
2 ccsbBroad304_01715 pLX_304 0% 57% 57% V5 0_1ins1260 n/a
3 TRCN0000469887 TTGCTATCGAGTTAACGCTTCTCG pLX_317 10.3% 57% 57% V5 0_1ins1260 n/a
Download CSV