Construct: ORF TRCN0000470038
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013629.1_s317c1
- Derived from:
- ccsbBroadEn_12101
- DNA Barcode:
- TCCAAATCTAAAAAGGGACATTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIGG (54872)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470038
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54872 | PIGG | phosphatidylinositol glycan... | XM_011513492.1 | 96.6% | 96.6% | 1_63del |
| 2 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_001345994.1 | 95.3% | 95.3% | 1_63del;233_234ins24 |
| 3 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_001345988.1 | 94.3% | 94.3% | 1_108del |
| 4 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_001345990.1 | 78.1% | 78.1% | 0_1ins396 |
| 5 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_001345991.1 | 78.1% | 78.1% | 0_1ins396 |
| 6 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_001289052.1 | 71% | 71% | 1_738del |
| 7 | human | 54872 | PIGG | phosphatidylinositol glycan... | XM_011513491.2 | 70.1% | 70.1% | 1_771del |
| 8 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_001289051.1 | 67.5% | 67.5% | 1_870del |
| 9 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_001345986.1 | 67.5% | 67.5% | 1_870del |
| 10 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_001345987.1 | 66.6% | 66.6% | 1_870del;1040_1041ins24 |
| 11 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_001127178.3 | 61.4% | 61.4% | 1_1137del |
| 12 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_017733.4 | 60.6% | 60.6% | 1_1137del;1307_1308ins24 |
| 13 | human | 54872 | PIGG | phosphatidylinositol glycan... | XM_011513490.3 | 55.1% | 53.6% | (many diffs) |
| 14 | human | 54872 | PIGG | phosphatidylinositol glycan... | NR_110293.1 | 48.5% | 1_1273del;1422_1423ins46;3040_3594del | |
| 15 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_001741255.2 | 48% | 1_1249del;1918_1919ins262;2800_2964del | |
| 16 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_001741253.2 | 47.6% | (many diffs) | |
| 17 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_001741248.2 | 46.8% | (many diffs) | |
| 18 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_001741251.2 | 46.5% | 1_1249del;2180_2846del;3729_3893del | |
| 19 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_001741262.2 | 45.3% | (many diffs) | |
| 20 | human | 54872 | PIGG | phosphatidylinositol glycan... | NR_144327.1 | 43.4% | 1_1273del;2396_2652del;3343_4172del | |
| 21 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_001741258.2 | 43.4% | (many diffs) | |
| 22 | human | 54872 | PIGG | phosphatidylinositol glycan... | NR_144328.1 | 40.2% | (many diffs) | |
| 23 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_924972.3 | 38.4% | (many diffs) | |
| 24 | human | 54872 | PIGG | phosphatidylinositol glycan... | NR_144330.1 | 38.3% | 1_1273del;2397_2398ins310;2776_3605del | |
| 25 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_924969.3 | 37.9% | (many diffs) | |
| 26 | human | 54872 | PIGG | phosphatidylinositol glycan... | NR_144326.1 | 37.8% | 1_1509del;3105_3737del;3955_4784del | |
| 27 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_002959736.1 | 36.3% | (many diffs) | |
| 28 | human | 54872 | PIGG | phosphatidylinositol glycan... | NR_144329.1 | 36.2% | (many diffs) | |
| 29 | human | 54872 | PIGG | phosphatidylinositol glycan... | NR_144331.1 | 36.1% | 1_1509del;2633_2634ins310;3012_3841del | |
| 30 | human | 54872 | PIGG | phosphatidylinositol glycan... | NR_144332.1 | 34.6% | 1_1273del;1748_1749ins455;2631_3460del | |
| 31 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_924965.3 | 29.1% | 1_1249del;2681_5668del;6050_6214del | |
| 32 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_001741259.2 | 29.1% | 1_1249del;1443_1471del;2179_2180ins911 | |
| 33 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_924967.3 | 25.4% | (many diffs) | |
| 34 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_001345989.2 | 21.6% | 18.6% | (many diffs) |
| 35 | human | 54872 | PIGG | phosphatidylinositol glycan... | NM_001289053.1 | 19.8% | 19.2% | (many diffs) |
| 36 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_001741254.2 | 17.4% | (many diffs) | |
| 37 | human | 54872 | PIGG | phosphatidylinositol glycan... | XM_011513494.3 | 16.9% | 16.3% | (many diffs) |
| 38 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_002959737.1 | 14.2% | (many diffs) | |
| 39 | human | 54872 | PIGG | phosphatidylinositol glycan... | XR_002959738.1 | 13.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1878
- ORF length:
- 1812
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc agaaagattg catgggaact ggatcagact gtacttggag gaaaagcatt 121 cagaagtcct attcaacctg ggctccaagg ttctcaggca gtacctggat gctctgaaga 181 cgctgagctt gtccctgagt gcacaagtgg cccagtacga catctattcg atgatggtgg 241 ggactgtcgt ggttttggag gttctcaccc tgctcctgct cagcgtccca caggcactgc 301 gcagaaaggc tgagctggaa gtcccactgt catctcctgg gttttctctg ctcttttatt 361 tggtgatcct ggttctttcg gccgttcacg tcattgtgtg cacctcagct gaaagttcgt 421 gctacttctg tggcctctcg tggctggcgg caggtggggt gatggtgctg gcctcggcgc 481 tgctgtgtgt gattgtgtct gttctgacca acgtgctcgt gggtggaaac accccaagga 541 agaaccccat gcatcccagc tcaaggtggt cagagctaga ccttcttatt ctgttgggga 601 cggcgggcca cgtcttgagc ctgggcgcca gcagcttcgt ggaggaggag caccagacct 661 ggtacttcct tgtgaacacc ctgtgtctag ctctgagcca agaaacctac agaaactact 721 ttctgggaga tgacggtgag cctccgtgtg gcctctgtgt ggaacaaggg catgacgggg 781 ccacagcagc gtggcaggac gggcctggct gtgatgtcct ggagcgagac aaaggccacg 841 gaagcccctc tacctccgaa gtgctcagag gccgcgagaa gtggatggtg ctggccagtc 901 cgtggctaat actggcctgc tgccggctgc tgcgctccct aaaccagaca ggtgtgcagt 961 gggctcaccg gcctgacctc ggccactggc tcaccagctc tgaccacaaa gccgagctct 1021 ctgtcctggc tgccctctcc ctcctcgtag tttttgtgct ggtgcagagg gggtgctccc 1081 ctgtgtccaa ggctgccctg gcgctggggc tgctgggcgt ctactgctac cgggcggcca 1141 tcgggagtgt ccggttcccg tggcggccgg acagcaagga catttccaag ggtattattg 1201 aagctcgttt tgtttatgtc tttgtccttg gcattctgtt cacgggcacc aaagacttac 1261 ttaaatctca agtcattgct gcagacttca aactcaagac tgtaggttta tgggagatat 1321 atagtggatt agttcttctg gcagccttgc tctttagacc acataatctt ccggtcttag 1381 catttagcct cttgattcag actctaatga ctaaattcat ctggaagccc ctgagacacg 1441 atgcagctga gattactgtg atgcattatt ggtttggtca agcatTCTTC TATTTTCAGG 1501 GCAACTCCAA CAACATTGCC ACCGTGGACA TCTCCGCAGG CTTCGTGGGC TTAGACACCT 1561 ACGTGGAAAT CCCAGCCGTG CTCCTGACAG CGTTTGGGAC GTACGCAGGG CCTGTGCTGT 1621 GGGCCAGCCA CTTAGTGCAC TTCCTGAGCT CAGAAACACG CAGTGGTTCA GCACTGAGTC 1681 ATGCTTGCTT CTGCTACGCA CTGATTTGTT CTATTCCAGT TTTCACGTAC ATCGTTTTGG 1741 TGACATCTCT GCGTTATCAT TTATTTATAT GGAGTGTATT TTCTCCAAAA CTTCTCTACG 1801 AGGGAATGCA CCTGCTCATT ACAGCTGCTG TCTGTGTATT CTTCACGGCA ATGGATCAAA 1861 CCAGACTCAC ACAGTCTTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1921 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1981 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATCCAAAT CTAAAAAGGG 2041 ACATTCTACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt