Transcript: Human XR_924972.3

PREDICTED: Homo sapiens phosphatidylinositol glycan anchor biosynthesis class G (PIGG), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIGG (54872)
Length:
2654
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_924972.3
NBCI Gene record:
PIGG (54872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_924972.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137809 GCAAGAGAATGTGCCGTCATA pLKO.1 1198 3UTR 100% 4.950 6.930 N PIGG n/a
2 TRCN0000135729 CAAGAGAATGTGCCGTCATAT pLKO.1 1199 3UTR 100% 13.200 10.560 N PIGG n/a
3 TRCN0000136173 GCAGCTTAGTAAACTGTTGCA pLKO.1 1180 3UTR 100% 2.640 2.112 N PIGG n/a
4 TRCN0000434753 GACATCTCTGCGTTATCATTT pLKO_005 2354 3UTR 100% 13.200 9.240 N PIGG n/a
5 TRCN0000134350 GCTAGACCTTCTTATTCTGTT pLKO.1 1759 3UTR 100% 4.950 3.465 N PIGG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_924972.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12101 pDONR223 100% 38.4% None (many diffs) n/a
2 ccsbBroad304_12101 pLX_304 0% 38.4% V5 (many diffs) n/a
3 TRCN0000470038 TCCAAATCTAAAAAGGGACATTCT pLX_317 21.9% 38.4% V5 (many diffs) n/a
Download CSV