Construct: ORF TRCN0000470114
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013216.1_s317c1
- Derived from:
- ccsbBroadEn_12559
- DNA Barcode:
- CCGTCGCATGGGTCTTTGTAAGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DCAF10 (79269)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470114
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79269 | DCAF10 | DDB1 and CUL4 associated fa... | XM_017015129.1 | 85.5% | 85.2% | 93G>C;150_260del |
2 | human | 79269 | DCAF10 | DDB1 and CUL4 associated fa... | NM_001286810.1 | 57.1% | 56.9% | 1_384del;477G>C;534_644del |
3 | human | 79269 | DCAF10 | DDB1 and CUL4 associated fa... | XM_017015128.1 | 48.3% | 48.2% | 1_705del;798G>C |
4 | human | 79269 | DCAF10 | DDB1 and CUL4 associated fa... | XM_005251578.4 | 44.7% | 44.6% | 1_705del;798G>C;855_965del |
5 | human | 79269 | DCAF10 | DDB1 and CUL4 associated fa... | XM_005251577.4 | 42.2% | 42.1% | 1_903del;996G>C |
6 | human | 79269 | DCAF10 | DDB1 and CUL4 associated fa... | NM_024345.5 | 39.4% | 39.3% | 1_903del;996G>C;1053_1163del |
7 | human | 79269 | DCAF10 | DDB1 and CUL4 associated fa... | XR_929331.2 | 8.1% | (many diffs) | |
8 | human | 79269 | DCAF10 | DDB1 and CUL4 associated fa... | XR_002956810.1 | 8% | (many diffs) | |
9 | human | 79269 | DCAF10 | DDB1 and CUL4 associated fa... | XR_002956809.1 | 7.8% | (many diffs) | |
10 | human | 79269 | DCAF10 | DDB1 and CUL4 associated fa... | XR_002956808.1 | 7.7% | (many diffs) | |
11 | mouse | 242418 | Dcaf10 | DDB1 and CUL4 associated fa... | XM_006537912.3 | 40.6% | 42.4% | (many diffs) |
12 | mouse | 242418 | Dcaf10 | DDB1 and CUL4 associated fa... | NM_153167.2 | 35.8% | 37.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 729
- ORF length:
- 663
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg aatgaggtta acaccagatt gttccaaaat gttgatttca acgtcctctg 121 gatatctctt aattttgcat gaccttgact taactaactc tttagaagta ggcagctatc 181 ccattttaag agcaagaaga actacttcaa gttcaggagt ttcaccacga aatagtcttg 241 aagtcgtaac ccctgaagtt cttggtgaga gtgaccacgg aaactgcatc acgtccttac 301 agctgcaccc aaaaggctgg gccactcttc ttcggtgctc aagcaacagt gatgatgagg 361 agtgtacttg tgtctatgaa ttccaagaag gagctccagt gcgacctgtc tcacctcgct 421 gttctctacg actgactcat tacattgaag aagccaatgt aggcaggggt tacatcaaag 481 aactttgctt cagccccgat ggacgaatga tttcttcccc acatggctat gggattcgct 541 tgttgggatt tgacaaacag tgCAGTGAAC TTGTTGACTG CTTGCCCAAA GAAGCCAGTC 601 CCCTGCGGGT GATCCGTTCT CTGTACTCTC ATAATGATGT GGTACTGACA ACAAAGTTCT 661 CTCCAACACA TTGTCAGATT GCCTCAGGGT GCCTTAGTGG ACGGGTTTCT TTGTATCAGC 721 CAAAGTTTTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 781 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 841 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACCGTCG CATGGGTCTT TGTAAGAAAC 901 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt