Transcript: Human XR_929331.2

PREDICTED: Homo sapiens DDB1 and CUL4 associated factor 10 (DCAF10), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCAF10 (79269)
Length:
8111
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_929331.2
NBCI Gene record:
DCAF10 (79269)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_929331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129184 CCGATGGACGAATGATTTCTT pLKO.1 1720 3UTR 100% 5.625 7.875 N DCAF10 n/a
2 TRCN0000129591 CCTTAGTGGACGGGTTTCTTT pLKO.1 1916 3UTR 100% 5.625 4.500 N DCAF10 n/a
3 TRCN0000130495 GATTTCAACGTCCTCTGGATA pLKO.1 1044 3UTR 100% 4.950 3.960 N DCAF10 n/a
4 TRCN0000130257 CGAATGAGGTTAACACCAGAT pLKO.1 1009 3UTR 100% 4.050 3.240 N DCAF10 n/a
5 TRCN0000249145 AGGAGTTTCACCACGAAATAG pLKO_005 1266 3UTR 100% 13.200 9.240 N Dcaf10 n/a
6 TRCN0000249146 GGGTGAAGAACATCGAATATG pLKO_005 866 3UTR 100% 13.200 9.240 N Dcaf10 n/a
7 TRCN0000128678 CTACGACTGACTCATTACATT pLKO.1 1650 3UTR 100% 5.625 3.938 N DCAF10 n/a
8 TRCN0000128786 CTGACAGTTGCTTGTGAACAA pLKO.1 649 3UTR 100% 4.950 3.465 N DCAF10 n/a
9 TRCN0000128239 GAGCAAGAAGAACTACTTCAA pLKO.1 1130 3UTR 100% 4.950 3.465 N DCAF10 n/a
10 TRCN0000129886 GACTCTTAGTAACATCAGGAT pLKO.1 899 3UTR 100% 2.640 1.848 N DCAF10 n/a
11 TRCN0000128959 GCTGATATGAAGACTTGCCTT pLKO.1 3068 3UTR 100% 2.640 1.848 N DCAF10 n/a
12 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4844 3UTR 100% 4.950 2.475 Y ORAI2 n/a
13 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4805 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4805 3UTR 100% 4.050 2.025 Y ORAI2 n/a
15 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4805 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 3578 3UTR 100% 13.200 6.600 Y IQCC n/a
17 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3513 3UTR 100% 13.200 6.600 Y LIAS n/a
18 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4841 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_929331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12560 pDONR223 100% 9.5% None 1_1005del;1411_1583del;1953_8111del n/a
2 ccsbBroad304_12560 pLX_304 0% 9.5% V5 1_1005del;1411_1583del;1953_8111del n/a
3 TRCN0000473222 GGTTGCCATGTTTACTTTTCCAAG pLX_317 61.2% 9.5% V5 1_1005del;1411_1583del;1953_8111del n/a
4 ccsbBroadEn_12559 pDONR223 100% 8.1% None (many diffs) n/a
5 ccsbBroad304_12559 pLX_304 0% 8.1% V5 (many diffs) n/a
6 TRCN0000470114 CCGTCGCATGGGTCTTTGTAAGAA pLX_317 25.9% 8.1% V5 (many diffs) n/a
Download CSV