Transcript: Human XM_005251578.4

PREDICTED: Homo sapiens DDB1 and CUL4 associated factor 10 (DCAF10), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCAF10 (79269)
Length:
2003
CDS:
19..1500

Additional Resources:

NCBI RefSeq record:
XM_005251578.4
NBCI Gene record:
DCAF10 (79269)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251578.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129184 CCGATGGACGAATGATTTCTT pLKO.1 1265 CDS 100% 5.625 7.875 N DCAF10 n/a
2 TRCN0000129591 CCTTAGTGGACGGGTTTCTTT pLKO.1 1461 CDS 100% 5.625 4.500 N DCAF10 n/a
3 TRCN0000130495 GATTTCAACGTCCTCTGGATA pLKO.1 762 CDS 100% 4.950 3.960 N DCAF10 n/a
4 TRCN0000130257 CGAATGAGGTTAACACCAGAT pLKO.1 727 CDS 100% 4.050 3.240 N DCAF10 n/a
5 TRCN0000249145 AGGAGTTTCACCACGAAATAG pLKO_005 984 CDS 100% 13.200 9.240 N Dcaf10 n/a
6 TRCN0000128678 CTACGACTGACTCATTACATT pLKO.1 1195 CDS 100% 5.625 3.938 N DCAF10 n/a
7 TRCN0000128786 CTGACAGTTGCTTGTGAACAA pLKO.1 565 CDS 100% 4.950 3.465 N DCAF10 n/a
8 TRCN0000128239 GAGCAAGAAGAACTACTTCAA pLKO.1 848 CDS 100% 4.950 3.465 N DCAF10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251578.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12560 pDONR223 100% 52.3% 52.3% None 1_705del n/a
2 ccsbBroad304_12560 pLX_304 0% 52.3% 52.3% V5 1_705del n/a
3 TRCN0000473222 GGTTGCCATGTTTACTTTTCCAAG pLX_317 61.2% 52.3% 52.3% V5 1_705del n/a
4 ccsbBroadEn_12559 pDONR223 100% 44.7% 44.6% None 1_705del;798G>C;855_965del n/a
5 ccsbBroad304_12559 pLX_304 0% 44.7% 44.6% V5 1_705del;798G>C;855_965del n/a
6 TRCN0000470114 CCGTCGCATGGGTCTTTGTAAGAA pLX_317 25.9% 44.7% 44.6% V5 1_705del;798G>C;855_965del n/a
Download CSV