Construct: ORF TRCN0000470136
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013448.1_s317c1
- Derived from:
- ccsbBroadEn_02405
- DNA Barcode:
- ATCATCAAGTGCACTAAAACGTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TFG (10342)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470136
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10342 | TFG | trafficking from ER to golg... | NM_001007565.2 | 100% | 100% | |
| 2 | human | 10342 | TFG | trafficking from ER to golg... | NM_001195478.1 | 100% | 100% | |
| 3 | human | 10342 | TFG | trafficking from ER to golg... | NM_006070.6 | 100% | 100% | |
| 4 | human | 10342 | TFG | trafficking from ER to golg... | XM_006713472.1 | 100% | 100% | |
| 5 | human | 10342 | TFG | trafficking from ER to golg... | XM_011512334.1 | 100% | 100% | |
| 6 | human | 10342 | TFG | trafficking from ER to golg... | NM_001195479.1 | 99% | 99% | 707_708insAGGTCAGATTGA |
| 7 | human | 10342 | TFG | trafficking from ER to golg... | XM_005247066.2 | 99% | 99% | 707_708insAGGTCAGATTGA |
| 8 | human | 10342 | TFG | trafficking from ER to golg... | XM_017005527.1 | 99% | 99% | 707_708insAGGTCAGATTGA |
| 9 | mouse | 21787 | Tfg | Trk-fused gene | NM_019678.3 | 89.9% | 93.5% | (many diffs) |
| 10 | mouse | 21787 | Tfg | Trk-fused gene | XM_006521980.2 | 89.9% | 93.5% | (many diffs) |
| 11 | mouse | 21787 | Tfg | Trk-fused gene | XM_006521981.3 | 88.9% | 92.5% | (many diffs) |
| 12 | mouse | 21787 | Tfg | Trk-fused gene | NM_001252443.1 | 78.1% | 81.7% | (many diffs) |
| 13 | mouse | 21787 | Tfg | Trk-fused gene | XM_006521982.3 | 63.7% | 65.8% | (many diffs) |
| 14 | mouse | 21787 | Tfg | Trk-fused gene | XM_006521983.3 | 62.7% | 64.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1266
- ORF length:
- 1200
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa cggacagttg gatctaagtg ggaagctaat catcaaagct caacttgggg 121 aggatattcg gcgaattcct attcataatg aagatattac ttatgatgaa ttagtgctaa 181 tgatgcaacg agttttcaga ggaaaacttc tgagtaatga tgaagtaaca ataaagtata 241 aagatgaaga tggagatctt ataacaattt ttgatagttc tgacctttcc tttgcaattc 301 agtgcagtag gatactgaaa ctgacattat ttgttaatgg ccagccaaga ccccttgaat 361 caagtcaggt gaaatatctc cgtcgagaac tgatagaact tcgaaataaa gtgaatcgtt 421 tattggatag cttggaacca cctggagaac caggaccttc caccaatatt cctgaaaatg 481 atactgtgga tggtagggaa gaaaagtctg cttctgattc ttctggaaaa cagtctactc 541 aggttatggc agcaagtatg tctgcttttg atcctttaaa aaaccaagat gaaatcaata 601 aaaatgttat gtcagcgttt ggcttaacag atgatcaggt ttcagggcca cccagtgctc 661 ctgcagaaga tcgttcagga acacccgaca gcattgcttc ctcctcctca gcagctcacc 721 caccaggcgt tcagccacag cagccaccat atacaggagc tcagactcaa gcaggtcaga 781 ttgaaggtca gatgtaccaa cagtaccagc aacaggccgg ctatggtgca cagcagccgc 841 aggctccacc tcagcagcct caacagtatg gtattcagta ttcagcaagc tatagtcagc 901 agactggacc tcaacaaccT CAGCAGTTCC AGGGATATGG CCAGCAACCA ACTTCCCAGG 961 CACCAGCTCC TGCCTTTTCT GGTCAGCCTC AACAACTGCC TGCTCAGCCG CCACAGCAGT 1021 ACCAGGCGAG CAATTATCCT GCACAAACTT ACACTGCCCA AACTTCTCAG CCTACTAATT 1081 ATACTGTGGC TCCTGCCTCT CAACCTGGAA TGGCTCCAAG CCAACCTGGG GCCTATCAAC 1141 CAAGACCAGG TTTTACTTCA CTTCCTGGAA GTACCATGAC CCCTCCTCCA AGTGGGCCTA 1201 ATCCTTATGC GCGTAACCGT CCTCCCTTTG GTCAGGGCTA TACCCAACCT GGACCTGGTT 1261 ATCGATACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1321 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1381 CTTGGCTTTA TATATCTTGT GGAAAGGACG AATCATCAAG TGCACTAAAA CGTCCACGCG 1441 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt