Transcript: Mouse XM_006521981.3

PREDICTED: Mus musculus Trk-fused gene (Tfg), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tfg (21787)
Length:
1656
CDS:
318..1499

Additional Resources:

NCBI RefSeq record:
XM_006521981.3
NBCI Gene record:
Tfg (21787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339295 GCTAATGATGCAGCGAGTATT pLKO_005 428 CDS 100% 13.200 18.480 N Tfg n/a
2 TRCN0000339226 CTGGACCTGGTTATCGATAAG pLKO_005 1480 CDS 100% 10.800 15.120 N Tfg n/a
3 TRCN0000339299 CTTACCCTCCACAAACGTATA pLKO_005 1264 CDS 100% 10.800 15.120 N Tfg n/a
4 TRCN0000079120 CGAAATAAAGTGAATCGCTTA pLKO.1 654 CDS 100% 4.050 5.670 N Tfg n/a
5 TRCN0000079121 CCGACGAATTCCCATTCATAA pLKO.1 380 CDS 100% 0.000 0.000 N Tfg n/a
6 TRCN0000339297 ACTGGTAGAACTTCGAAATAA pLKO_005 641 CDS 100% 15.000 10.500 N Tfg n/a
7 TRCN0000079122 CGTCGAGAACTGGTAGAACTT pLKO.1 633 CDS 100% 4.950 3.465 N Tfg n/a
8 TRCN0000079119 GCAGCGAGTATTCAGAGGAAA pLKO.1 437 CDS 100% 4.950 3.465 N Tfg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02405 pDONR223 100% 88.9% 92.5% None (many diffs) n/a
2 ccsbBroad304_02405 pLX_304 0% 88.9% 92.5% V5 (many diffs) n/a
3 TRCN0000470136 ATCATCAAGTGCACTAAAACGTCC pLX_317 29.2% 88.9% 92.5% V5 (many diffs) n/a
4 ccsbBroadEn_15704 pDONR223 0% 82.9% 52.4% None (many diffs) n/a
5 ccsbBroad304_15704 pLX_304 0% 82.9% 52.4% V5 (many diffs) n/a
6 TRCN0000476121 TGACGCCCTATAAAGAGCGGCAAT pLX_317 36.9% 82.9% 52.4% V5 (many diffs) n/a
Download CSV