Transcript: Human NM_001195478.1

Homo sapiens trafficking from ER to golgi regulator (TFG), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
TFG (10342)
Length:
1746
CDS:
91..1293

Additional Resources:

NCBI RefSeq record:
NM_001195478.1
NBCI Gene record:
TFG (10342)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001195478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339226 CTGGACCTGGTTATCGATAAG pLKO_005 1274 CDS 100% 10.800 15.120 N Tfg n/a
2 TRCN0000078660 CCCAAACTTCTCAGCCTACTA pLKO.1 1082 CDS 100% 4.950 6.930 N TFG n/a
3 TRCN0000311702 CCCAAACTTCTCAGCCTACTA pLKO_005 1082 CDS 100% 4.950 6.930 N TFG n/a
4 TRCN0000078661 GCGTTTGGCTTAACAGATGAT pLKO.1 640 CDS 100% 4.950 6.930 N TFG n/a
5 TRCN0000311701 GCGTTTGGCTTAACAGATGAT pLKO_005 640 CDS 100% 4.950 6.930 N TFG n/a
6 TRCN0000078659 GCCTAATCCTTATGCGCGTAA pLKO.1 1221 CDS 100% 4.050 5.670 N TFG n/a
7 TRCN0000349343 GCCTAATCCTTATGCGCGTAA pLKO_005 1221 CDS 100% 4.050 5.670 N TFG n/a
8 TRCN0000078658 CTTAGTTACTTTGGAACACTA pLKO.1 1506 3UTR 100% 4.950 3.465 N TFG n/a
9 TRCN0000311703 CTTAGTTACTTTGGAACACTA pLKO_005 1506 3UTR 100% 4.950 3.465 N TFG n/a
10 TRCN0000078662 GCACAAACTTACACTGCCCAA pLKO.1 1066 CDS 100% 2.160 1.512 N TFG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02405 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02405 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470136 ATCATCAAGTGCACTAAAACGTCC pLX_317 29.2% 100% 100% V5 n/a
4 ccsbBroadEn_15704 pDONR223 0% 91.5% 53.6% None 708_719del;741delC;1112_1200del n/a
5 ccsbBroad304_15704 pLX_304 0% 91.5% 53.6% V5 708_719del;741delC;1112_1200del n/a
6 TRCN0000476121 TGACGCCCTATAAAGAGCGGCAAT pLX_317 36.9% 91.5% 53.6% V5 708_719del;741delC;1112_1200del n/a
Download CSV