Transcript: Mouse NM_001252443.1

Mus musculus Trk-fused gene (Tfg), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Tfg (21787)
Length:
1801
CDS:
313..1359

Additional Resources:

NCBI RefSeq record:
NM_001252443.1
NBCI Gene record:
Tfg (21787)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339295 GCTAATGATGCAGCGAGTATT pLKO_005 423 CDS 100% 13.200 18.480 N Tfg n/a
2 TRCN0000339298 TGTAGCCGCTTCCTAGTTATT pLKO_005 1574 3UTR 100% 13.200 18.480 N Tfg n/a
3 TRCN0000339226 CTGGACCTGGTTATCGATAAG pLKO_005 1340 CDS 100% 10.800 15.120 N Tfg n/a
4 TRCN0000339299 CTTACCCTCCACAAACGTATA pLKO_005 1124 CDS 100% 10.800 15.120 N Tfg n/a
5 TRCN0000079121 CCGACGAATTCCCATTCATAA pLKO.1 375 CDS 100% 0.000 0.000 N Tfg n/a
6 TRCN0000079119 GCAGCGAGTATTCAGAGGAAA pLKO.1 432 CDS 100% 4.950 3.465 N Tfg n/a
7 TRCN0000079118 GCTTTCTAGTTTCCCAGAGAA pLKO.1 1631 3UTR 100% 4.950 3.465 N Tfg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02405 pDONR223 100% 78.1% 81.7% None (many diffs) n/a
2 ccsbBroad304_02405 pLX_304 0% 78.1% 81.7% V5 (many diffs) n/a
3 TRCN0000470136 ATCATCAAGTGCACTAAAACGTCC pLX_317 29.2% 78.1% 81.7% V5 (many diffs) n/a
4 ccsbBroadEn_15704 pDONR223 0% 70.3% 42.1% None (many diffs) n/a
5 ccsbBroad304_15704 pLX_304 0% 70.3% 42.1% V5 (many diffs) n/a
6 TRCN0000476121 TGACGCCCTATAAAGAGCGGCAAT pLX_317 36.9% 70.3% 42.1% V5 (many diffs) n/a
Download CSV