Construct: ORF TRCN0000470183
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009390.1_s317c1
- Derived from:
- ccsbBroadEn_12108
- DNA Barcode:
- GGCCCCCGACGGACCTGCCCACGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TTC19 (54902)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470183
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54902 | TTC19 | tetratricopeptide repeat do... | NM_001271420.2 | 100% | 100% | |
| 2 | human | 54902 | TTC19 | tetratricopeptide repeat do... | NM_017775.4 | 71.8% | 71.8% | 1_321del |
| 3 | human | 54902 | TTC19 | tetratricopeptide repeat do... | XM_017024801.2 | 61.1% | 58.8% | (many diffs) |
| 4 | human | 54902 | TTC19 | tetratricopeptide repeat do... | XM_017024802.2 | 59.8% | 58.9% | (many diffs) |
| 5 | human | 54902 | TTC19 | tetratricopeptide repeat do... | XM_024450814.1 | 33% | 31.8% | (many diffs) |
| 6 | mouse | 72795 | Ttc19 | tetratricopeptide repeat do... | NM_028360.2 | 64% | 65.2% | (many diffs) |
| 7 | mouse | 72795 | Ttc19 | tetratricopeptide repeat do... | NM_029704.2 | 60.7% | 61.7% | (many diffs) |
| 8 | mouse | 72795 | Ttc19 | tetratricopeptide repeat do... | XM_006534321.3 | 58.5% | 56.3% | (many diffs) |
| 9 | mouse | 72795 | Ttc19 | tetratricopeptide repeat do... | XR_001780062.1 | 30.2% | (many diffs) | |
| 10 | mouse | 72795 | Ttc19 | tetratricopeptide repeat do... | XR_001780061.1 | 30.2% | (many diffs) | |
| 11 | mouse | 72795 | Ttc19 | tetratricopeptide repeat do... | XR_388537.3 | 28.1% | (many diffs) | |
| 12 | mouse | 72795 | Ttc19 | tetratricopeptide repeat do... | XR_001780063.1 | 26.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 885
- ORF length:
- 819
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa agatgagcca gaagaggctg agttaatttt gcatgacgct cttcgtctcg 121 cctatcagac tgataacaag aaggccatca cttacactta tgatttgatg gccaacttag 181 catttatacg gggtcagctt gaaaatgctg aacaactttt taaagcaaca atgagttacc 241 tccttggagg gggcatgaag caggaggaca atgcaataat tgaaatttcc ctaaagctgg 301 ccagtatcta tgctgcgcag aacagacagg aatttgctgt tgctggctat gaattctgca 361 tttcaactct agaggaaaaa attgaaagag aaaaggaatt agcagaagac attatgtcag 421 tggaagagaa agccaatacc cacctcctct tgggcatgtg cttagacgcc tgtgctcgct 481 accttctgtt ctccaagcag ccgtcacagg cacaaaggat gtatgaaaaa gctctgcaga 541 tttctgaaga aatacaaGGA GAAAGACACC CACAGACCAT TGTGCTGATG AGTGACCTGG 601 CTACTACCCT GGATGCACAG GGCCGCTTTG ATGAGGCCTA TATTTATATG CAAAGGGCAT 661 CAGATCTGGC AAGACAGATA AATCATCCTG AGCTACACAT GGTACTCAGT AATCTAGCTG 721 CAGTTTTGAT GCACAGAGAA CGATATACAC AAGCAAAAGA GATCTACCAG GAAGCACTGA 781 AGCAAGCAAA GCTGAAAAAA GATGAAATTT CTGTACAACA CATCAGGGAA GAGTTGGCTG 841 AGCTGTCAAA GAAAAGTAGA CCTTTGACAA ATTCTGTCAA GCTCTACCCA ACTTTCTTGT 901 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 961 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1021 GAAAGGACGA GGCCCCCGAC GGACCTGCCC ACGAACGCGT TAAGTCgaca atcaacctct 1081 ggattacaaa atttgtgaaa gatt