Transcript: Mouse XM_006534321.3

PREDICTED: Mus musculus tetratricopeptide repeat domain 19 (Ttc19), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttc19 (72795)
Length:
1568
CDS:
55..1110

Additional Resources:

NCBI RefSeq record:
XM_006534321.3
NBCI Gene record:
Ttc19 (72795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534321.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215601 GATCTGGCAAGAGAGATAAAT pLKO.1 943 CDS 100% 15.000 21.000 N Ttc19 n/a
2 TRCN0000248996 GATCTGGCAAGAGAGATAAAT pLKO_005 943 CDS 100% 15.000 21.000 N Ttc19 n/a
3 TRCN0000248994 AGGAATTAGCAGAAGATATTA pLKO_005 677 CDS 100% 15.000 10.500 N Ttc19 n/a
4 TRCN0000215541 GGAATTAGCAGAAGATATTAT pLKO.1 678 CDS 100% 15.000 10.500 N Ttc19 n/a
5 TRCN0000248997 CTTTGATGATGCCTACATTTA pLKO_005 906 CDS 100% 13.200 9.240 N Ttc19 n/a
6 TRCN0000248998 ATGACCTGATGGCCAACTTAG pLKO_005 443 CDS 100% 10.800 7.560 N Ttc19 n/a
7 TRCN0000194127 GCTGCTCAGAATAAACAGGAA pLKO.1 595 CDS 100% 2.640 1.848 N Ttc19 n/a
8 TRCN0000167945 CAGGCACAAAGGATGTATGAA pLKO.1 787 CDS 100% 5.625 3.375 N TTC19 n/a
9 TRCN0000350810 CAGGCACAAAGGATGTATGAA pLKO_005 787 CDS 100% 5.625 3.375 N TTC19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534321.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12108 pDONR223 100% 58.5% 56.3% None (many diffs) n/a
2 ccsbBroad304_12108 pLX_304 0% 58.5% 56.3% V5 (many diffs) n/a
3 TRCN0000470183 GGCCCCCGACGGACCTGCCCACGA pLX_317 40.2% 58.5% 56.3% V5 (many diffs) n/a
Download CSV