Transcript: Human XM_017024802.2

PREDICTED: Homo sapiens tetratricopeptide repeat domain 19 (TTC19), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC19 (54902)
Length:
1607
CDS:
79..1086

Additional Resources:

NCBI RefSeq record:
XM_017024802.2
NBCI Gene record:
TTC19 (54902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323248 CCGCTTTGATGAGGCCTATAT pLKO_005 957 CDS 100% 13.200 18.480 N TTC19 n/a
2 TRCN0000168621 GCAACAATGAGTTACCTCCTT pLKO.1 559 CDS 100% 2.640 2.112 N TTC19 n/a
3 TRCN0000167945 CAGGCACAAAGGATGTATGAA pLKO.1 841 CDS 100% 5.625 3.938 N TTC19 n/a
4 TRCN0000350810 CAGGCACAAAGGATGTATGAA pLKO_005 841 CDS 100% 5.625 3.938 N TTC19 n/a
5 TRCN0000167706 GCAAGACAGATAAATCATCCT pLKO.1 1003 CDS 100% 2.640 1.848 N TTC19 n/a
6 TRCN0000323169 GCAAGACAGATAAATCATCCT pLKO_005 1003 CDS 100% 2.640 1.848 N TTC19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12108 pDONR223 100% 59.8% 58.9% None (many diffs) n/a
2 ccsbBroad304_12108 pLX_304 0% 59.8% 58.9% V5 (many diffs) n/a
3 TRCN0000470183 GGCCCCCGACGGACCTGCCCACGA pLX_317 40.2% 59.8% 58.9% V5 (many diffs) n/a
Download CSV