Construct: ORF TRCN0000470274
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003264.1_s317c1
- Derived from:
- ccsbBroadEn_15371
- DNA Barcode:
- AATAGACTGCACTAGCTTCGTGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CA8 (767)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470274
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 767 | CA8 | carbonic anhydrase 8 | NM_001321837.2 | 99.8% | 100% | 327A>G |
2 | human | 767 | CA8 | carbonic anhydrase 8 | NM_004056.6 | 99.8% | 100% | 327A>G |
3 | human | 767 | CA8 | carbonic anhydrase 8 | NM_001321839.2 | 88.8% | 88.9% | 327A>G;415_416ins96 |
4 | human | 767 | CA8 | carbonic anhydrase 8 | NM_001321838.2 | 88.5% | 86.2% | (many diffs) |
5 | human | 767 | CA8 | carbonic anhydrase 8 | XM_017013818.1 | 69% | 67% | (many diffs) |
6 | human | 767 | CA8 | carbonic anhydrase 8 | XM_011517588.3 | 53% | 46.2% | (many diffs) |
7 | human | 767 | CA8 | carbonic anhydrase 8 | XM_011517587.2 | 51.9% | 48.4% | (many diffs) |
8 | human | 767 | CA8 | carbonic anhydrase 8 | NR_135821.2 | 15% | (many diffs) | |
9 | mouse | 12319 | Car8 | carbonic anhydrase 8 | NM_007592.3 | 89.5% | 98.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 936
- ORF length:
- 870
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggacctgagc ttcatcgaag ataccgtcgc cttccccgag aaggaagagg 121 atgaggagga agaagaggag ggtgtggagt ggggctacga ggaaggtgtt gagtggggtc 181 tggtgtttcc tgatgctaat ggggaatacc agtctcctat taacctaaac tcaagagagg 241 ctaggtatga cccctcgctg ttggatgtcc gcctctcccc aaattatgtg gtgtgccgag 301 actgtgaagt caccaatgat ggacatacca ttcaggttat cctgaagtca aaatcagttc 361 tttcgggagg accattgcct caagggcatg agtttgaact gtacgaagtg agatttcact 421 ggggaagaga aaaccagcgt ggttctgagc acacggttaa tttcaaagct tttcccatgg 481 agctccatct gatccactgg aactccactc tgtttggcag cattgatgag gctgtgggga 541 agccgcacgg aatcgccatc attgctctgt ttgttcagat aggaaaggaa catgttggct 601 tgaaggctgt gactgaaaTC CTCCAAGATA TTCAGTATAA GGGGAAGTCC AAAACAATAC 661 CTTGCTTTAA TCCTAACACT TTATTACCAG ACCCTCTGCT GCGGGATTAC TGGGTGTATG 721 AAGGCTCTCT CACCATCCCA CCTTGCAGTG AAGGTGTCAC CTGGATATTA TTCCGATACC 781 CTTTAACTAT ATCCCAGCTA CAGATAGAAG AATTTCGAAG GCTGAGGACA CATGTTAAGG 841 GGGCAGAACT TGTGGAAGGC TGTGATGGGA TTTTGGGAGA CAACTTTCGG CCCACTCAGC 901 CTCTTAGTGA CAGAGTCATT AGAGCTGCAT TTCAGTACCC AACTTTCTTG TACAAAGTGG 961 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1021 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1081 AAATAGACTG CACTAGCTTC GTGATACGCG TTAAGTCgac aatcaacctc tggattacaa 1141 aatttgtgaa agatt