Transcript: Human XM_011517587.2

PREDICTED: Homo sapiens carbonic anhydrase 8 (CA8), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CA8 (767)
Length:
1285
CDS:
249..740

Additional Resources:

NCBI RefSeq record:
XM_011517587.2
NBCI Gene record:
CA8 (767)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150778 GAACTGTACGAAGTGAGATTT pLKO.1 579 CDS 100% 13.200 18.480 N CA8 n/a
2 TRCN0000155916 CGAGACTGTGAAGTCACCAAT pLKO.1 480 CDS 100% 4.950 3.960 N CA8 n/a
3 TRCN0000151892 CCAGTCTCCTATTAACCTAAA pLKO.1 392 CDS 100% 10.800 7.560 N CA8 n/a
4 TRCN0000427628 GGACATACCATTCAGGTTATC pLKO_005 504 CDS 100% 10.800 7.560 N CA8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10705 pDONR223 100% 88.7% 87.7% None (many diffs) n/a
2 ccsbBroad304_10705 pLX_304 0% 88.7% 87.7% V5 (many diffs) n/a
3 TRCN0000467276 ACCTTCAATTATTCTCGGTAAAAT pLX_317 96% 88.7% 87.7% V5 (many diffs) n/a
4 ccsbBroadEn_00200 pDONR223 100% 52% 48.4% None (many diffs) n/a
5 ccsbBroad304_00200 pLX_304 0% 52% 48.4% V5 (many diffs) n/a
6 TRCN0000474299 CCCGGTTCTTGCTCCAAGCGACGC pLX_317 32% 52% 48.4% V5 (many diffs) n/a
7 ccsbBroadEn_15371 pDONR223 0% 51.9% 48.4% None (many diffs) n/a
8 ccsbBroad304_15371 pLX_304 0% 51.9% 48.4% V5 (many diffs) n/a
9 TRCN0000470274 AATAGACTGCACTAGCTTCGTGAT pLX_317 36.8% 51.9% 48.4% V5 (many diffs) n/a
Download CSV