Transcript: Human XM_017013818.1

PREDICTED: Homo sapiens carbonic anhydrase 8 (CA8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CA8 (767)
Length:
3888
CDS:
594..1214

Additional Resources:

NCBI RefSeq record:
XM_017013818.1
NBCI Gene record:
CA8 (767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150778 GAACTGTACGAAGTGAGATTT pLKO.1 672 CDS 100% 13.200 18.480 N CA8 n/a
2 TRCN0000155547 CGGGATTACTGGGTGTATGAA pLKO.1 978 CDS 100% 5.625 4.500 N CA8 n/a
3 TRCN0000155916 CGAGACTGTGAAGTCACCAAT pLKO.1 480 5UTR 100% 4.950 3.960 N CA8 n/a
4 TRCN0000413994 GGAAGACAATGGTCCTATAAT pLKO_005 1252 3UTR 100% 15.000 10.500 N CA8 n/a
5 TRCN0000151892 CCAGTCTCCTATTAACCTAAA pLKO.1 392 5UTR 100% 10.800 7.560 N CA8 n/a
6 TRCN0000427628 GGACATACCATTCAGGTTATC pLKO_005 504 5UTR 100% 10.800 7.560 N CA8 n/a
7 TRCN0000153276 GCCATCATTGCTCTGTTTGTT pLKO.1 831 CDS 100% 5.625 3.938 N CA8 n/a
8 TRCN0000151716 CACCTGGATATTATTCCGATA pLKO.1 1034 CDS 100% 4.050 2.835 N CA8 n/a
9 TRCN0000114515 CCCTTTAACTATATCCCAGAT pLKO.1 1055 CDS 100% 4.050 5.670 N Car8 n/a
10 TRCN0000335398 CCCTTTAACTATATCCCAGAT pLKO_005 1055 CDS 100% 4.050 5.670 N Car8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00200 pDONR223 100% 69.2% 67% None (many diffs) n/a
2 ccsbBroad304_00200 pLX_304 0% 69.2% 67% V5 (many diffs) n/a
3 TRCN0000474299 CCCGGTTCTTGCTCCAAGCGACGC pLX_317 32% 69.2% 67% V5 (many diffs) n/a
4 ccsbBroadEn_15371 pDONR223 0% 69% 67% None (many diffs) n/a
5 ccsbBroad304_15371 pLX_304 0% 69% 67% V5 (many diffs) n/a
6 TRCN0000470274 AATAGACTGCACTAGCTTCGTGAT pLX_317 36.8% 69% 67% V5 (many diffs) n/a
7 ccsbBroadEn_10705 pDONR223 100% 21.6% 16% None (many diffs) n/a
8 ccsbBroad304_10705 pLX_304 0% 21.6% 16% V5 (many diffs) n/a
9 TRCN0000467276 ACCTTCAATTATTCTCGGTAAAAT pLX_317 96% 21.6% 16% V5 (many diffs) n/a
Download CSV