Construct: ORF TRCN0000470310
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009932.1_s317c1
- Derived from:
- ccsbBroadEn_07267
- DNA Barcode:
- TGTTTCAGGTTTCAACTTGTGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PDLIM4 (8572)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470310
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8572 | PDLIM4 | PDZ and LIM domain 4 | NM_003687.4 | 99.8% | 100% | 255T>C |
| 2 | human | 8572 | PDLIM4 | PDZ and LIM domain 4 | XM_017010002.1 | 76.3% | 76.3% | 92_93ins234 |
| 3 | human | 8572 | PDLIM4 | PDZ and LIM domain 4 | NM_001131027.1 | 74.4% | 69.1% | 255T>C;670_671ins118;738_739ins134 |
| 4 | mouse | 30794 | Pdlim4 | PDZ and LIM domain 4 | NM_019417.3 | 85.3% | 90.9% | (many diffs) |
| 5 | mouse | 30794 | Pdlim4 | PDZ and LIM domain 4 | XM_030246067.1 | 69.5% | 73.4% | (many diffs) |
| 6 | mouse | 30794 | Pdlim4 | PDZ and LIM domain 4 | XM_006533511.2 | 63.8% | 61% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1056
- ORF length:
- 990
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc ccattccgtg accctgcgcg ggccttcgcc ctggggcttc cgcctggtgg 121 gcggccggga cttcagcgcg cccctcacca tctcacgggt ccatgctggc agcaaggctg 181 cattggctgc cctgtgccca ggagacctga tccaggccat caatggtgag agcacagagc 241 tcatgacaca cctggaggca cagaaccgca tcaagggctg ccacgatcac ctcacactgt 301 ctgtgagcag gcctgagggc aggagctggc ccagtgcccc tgatgacagc aaggctcagg 361 cacacaggat ccacatcgat cctgagatcc aggacggcag cccaacaacc agcaggcggc 421 cctcaggcac cgggactggg ccagaagatg gcagaccaag cctgggatct ccatatggac 481 aaccccctcg ctttccagtc cctcacaatg gcagcagcga ggccaccctg ccagcccaga 541 tgagcaccct gcatgtgtct ccacccccca gcgctgaccc agccagaggc ctcccgcgga 601 gccgggactg cagagtcgac ctgggctccg aggtgtacag gatgctgcgg gagccagccg 661 agcccgtggc cgcggagccc aagcagtcag gctccttccg ctacttgcag ggcatgcTAG 721 AGGCCGGCGA GGGCGGGGAT TGGCCCGGGC CTGGCGGCCC CCGGAACCTC AAGCCCACGG 781 CCAGCAAGCT GGGCGCTCCG CTGAGCGGCC TGCAGGGGCT GCCCGAGTGC ACGCGCTGCG 841 GCCACGGCAT CGTGGGCACC ATCGTCAAGG CACGGGACAA GCTCTACCAT CCCGAGTGCT 901 TCATGTGCAG TGACTGCGGC CTGAACCTCA AGCAGCGTGG TTACTTCTTT CTGGACGAGC 961 GGCTCTACTG TGAGAGCCAC GCCAAGGCGC GCGTGAAGCC GCCCGAGGGC TACGACGTGG 1021 TGGCGGTGTA CCCCAATGCC AAGGTGGAAC TCGTCTGCCC AACTTTCTTG TACAAAGTGG 1081 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1141 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1201 ATGTTTCAGG TTTCAACTTG TGCCAACGCG TTAAGTCgac aatcaacctc tggattacaa 1261 aatttgtgaa agatt