Transcript: Human XM_017010002.1

PREDICTED: Homo sapiens PDZ and LIM domain 4 (PDLIM4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDLIM4 (8572)
Length:
2048
CDS:
65..823

Additional Resources:

NCBI RefSeq record:
XM_017010002.1
NBCI Gene record:
PDLIM4 (8572)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010002.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422696 CTACTTGCAGGGCATGCTAGA pLKO_005 466 CDS 100% 4.050 5.670 N PDLIM4 n/a
2 TRCN0000074181 CTACTGTGAGAGCCACGCCAA pLKO.1 730 CDS 100% 0.720 1.008 N PDLIM4 n/a
3 TRCN0000074182 CCACGGCATCGTGGGCACCAT pLKO.1 607 CDS 100% 0.000 0.000 N PDLIM4 n/a
4 TRCN0000074179 CGCTTTCCAGTCCCTCACAAT pLKO.1 254 CDS 100% 4.950 3.465 N PDLIM4 n/a
5 TRCN0000426206 GAACCTCAAGCAGCGTGGTTA pLKO_005 688 CDS 100% 4.950 3.465 N PDLIM4 n/a
6 TRCN0000074178 CGTCTGTGAATTGTGGCTGTT pLKO.1 1733 3UTR 100% 4.050 2.835 N PDLIM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010002.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07267 pDONR223 100% 76.3% 76.3% None 92_93ins234 n/a
2 ccsbBroad304_07267 pLX_304 0% 76.3% 76.3% V5 92_93ins234 n/a
3 TRCN0000470310 TGTTTCAGGTTTCAACTTGTGCCA pLX_317 34.5% 76.3% 76.3% V5 92_93ins234 n/a
4 ccsbBroadEn_15639 pDONR223 0% 50.8% 45.6% None (many diffs) n/a
5 ccsbBroad304_15639 pLX_304 0% 50.8% 45.6% V5 (many diffs) n/a
Download CSV