Transcript: Mouse XM_030246067.1

PREDICTED: Mus musculus PDZ and LIM domain 4 (Pdlim4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pdlim4 (30794)
Length:
1060
CDS:
138..953

Additional Resources:

NCBI RefSeq record:
XM_030246067.1
NBCI Gene record:
Pdlim4 (30794)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030246067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075388 GAACGGCTGTACTGTGAGAAT pLKO.1 852 CDS 100% 4.950 3.465 N Pdlim4 n/a
2 TRCN0000075391 TGAACGGCTGTACTGTGAGAA pLKO.1 851 CDS 100% 4.950 3.465 N Pdlim4 n/a
3 TRCN0000075390 CAAGGCTCAAGCACATAGGAT pLKO.1 242 CDS 100% 3.000 2.100 N Pdlim4 n/a
4 TRCN0000075392 GCGAGAGACAAGCTCTACCAT pLKO.1 765 CDS 100% 3.000 2.100 N Pdlim4 n/a
5 TRCN0000075389 AGGTGACTTGATCCAAGCCAT pLKO.1 95 5UTR 100% 2.640 1.848 N Pdlim4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030246067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07267 pDONR223 100% 69.5% 73.4% None (many diffs) n/a
2 ccsbBroad304_07267 pLX_304 0% 69.5% 73.4% V5 (many diffs) n/a
3 TRCN0000470310 TGTTTCAGGTTTCAACTTGTGCCA pLX_317 34.5% 69.5% 73.4% V5 (many diffs) n/a
Download CSV