Transcript: Human NM_001271781.1

Homo sapiens proteasome 26S subunit, non-ATPase 6 (PSMD6), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
PSMD6 (9861)
Length:
1242
CDS:
54..1106

Additional Resources:

NCBI RefSeq record:
NM_001271781.1
NBCI Gene record:
PSMD6 (9861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143904 CAGGAACTGTCCAGGTTTATT pLKO.1 930 CDS 100% 15.000 21.000 N PSMD6 n/a
2 TRCN0000292337 CAGGAACTGTCCAGGTTTATT pLKO_005 930 CDS 100% 15.000 21.000 N PSMD6 n/a
3 TRCN0000145517 GCTGGAATCATATAGGTCATT pLKO.1 857 CDS 100% 4.950 3.960 N PSMD6 n/a
4 TRCN0000144555 GCAGTACCAAGAAACTATCAA pLKO.1 1028 CDS 100% 5.625 3.938 N PSMD6 n/a
5 TRCN0000292294 GCAGTACCAAGAAACTATCAA pLKO_005 1028 CDS 100% 5.625 3.938 N PSMD6 n/a
6 TRCN0000142957 CTTGAAGTGTTGCACAGTCTT pLKO.1 675 CDS 100% 4.950 3.465 N PSMD6 n/a
7 TRCN0000343967 CTTGAAGTGTTGCACAGTCTT pLKO_005 675 CDS 100% 4.950 3.465 N PSMD6 n/a
8 TRCN0000139882 GACAGCCTTTCGCAAGACATA pLKO.1 299 CDS 100% 4.950 3.465 N PSMD6 n/a
9 TRCN0000297976 GACAGCCTTTCGCAAGACATA pLKO_005 299 CDS 100% 4.950 3.465 N PSMD6 n/a
10 TRCN0000139867 GATCAGGAACTGTCCAGGTTT pLKO.1 927 CDS 100% 4.950 3.465 N PSMD6 n/a
11 TRCN0000121679 GAAACTATCAAGAAAGGAGAT pLKO.1 1038 CDS 100% 4.050 2.835 N PSMD6 n/a
12 TRCN0000139027 CCAATCATTAGCGGTTGTGGA pLKO.1 752 CDS 100% 2.640 1.848 N PSMD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02262 pDONR223 100% 89.9% 89.7% None 28_29ins117 n/a
2 ccsbBroad304_02262 pLX_304 0% 89.9% 89.7% V5 28_29ins117 n/a
3 TRCN0000470350 CGGTCAGACGATATGCCCAGTATT pLX_317 41.1% 89.9% 89.7% V5 28_29ins117 n/a
Download CSV